ID: 1175177890

View in Genome Browser
Species Human (GRCh38)
Location 20:57124410-57124432
Sequence TCACTTCGAAGCCTGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175177890_1175177892 -1 Left 1175177890 20:57124410-57124432 CCAAGTGCCAGGCTTCGAAGTGA No data
Right 1175177892 20:57124432-57124454 ACTTCCACCCACCCTTCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175177890 Original CRISPR TCACTTCGAAGCCTGGCACT TGG (reversed) Intergenic
No off target data available for this crispr