ID: 1175177891

View in Genome Browser
Species Human (GRCh38)
Location 20:57124417-57124439
Sequence GTGGAAGTCACTTCGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175177891_1175177892 -8 Left 1175177891 20:57124417-57124439 CCAGGCTTCGAAGTGACTTCCAC No data
Right 1175177892 20:57124432-57124454 ACTTCCACCCACCCTTCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175177891 Original CRISPR GTGGAAGTCACTTCGAAGCC TGG (reversed) Intergenic