ID: 1175177892

View in Genome Browser
Species Human (GRCh38)
Location 20:57124432-57124454
Sequence ACTTCCACCCACCCTTCGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175177891_1175177892 -8 Left 1175177891 20:57124417-57124439 CCAGGCTTCGAAGTGACTTCCAC No data
Right 1175177892 20:57124432-57124454 ACTTCCACCCACCCTTCGTCTGG No data
1175177888_1175177892 12 Left 1175177888 20:57124397-57124419 CCTGCAGGAGGCTCCAAGTGCCA No data
Right 1175177892 20:57124432-57124454 ACTTCCACCCACCCTTCGTCTGG No data
1175177890_1175177892 -1 Left 1175177890 20:57124410-57124432 CCAAGTGCCAGGCTTCGAAGTGA No data
Right 1175177892 20:57124432-57124454 ACTTCCACCCACCCTTCGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175177892 Original CRISPR ACTTCCACCCACCCTTCGTC TGG Intergenic
No off target data available for this crispr