ID: 1175178333

View in Genome Browser
Species Human (GRCh38)
Location 20:57127302-57127324
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175178325_1175178333 13 Left 1175178325 20:57127266-57127288 CCATTTGCATTTCCCTGCCTCTC No data
Right 1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG No data
1175178326_1175178333 1 Left 1175178326 20:57127278-57127300 CCCTGCCTCTCTCCTGCTTTGTC No data
Right 1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG No data
1175178327_1175178333 0 Left 1175178327 20:57127279-57127301 CCTGCCTCTCTCCTGCTTTGTCC No data
Right 1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG No data
1175178328_1175178333 -4 Left 1175178328 20:57127283-57127305 CCTCTCTCCTGCTTTGTCCGCTA No data
Right 1175178333 20:57127302-57127324 GCTACCTTCTGCACTGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175178333 Original CRISPR GCTACCTTCTGCACTGGTGG AGG Intergenic