ID: 1175181360

View in Genome Browser
Species Human (GRCh38)
Location 20:57149998-57150020
Sequence CTCACTTTCCAACCTGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175181360_1175181361 -9 Left 1175181360 20:57149998-57150020 CCAGCGTCAGGTTGGAAAGTGAG No data
Right 1175181361 20:57150012-57150034 GAAAGTGAGCCACATTACACAGG No data
1175181360_1175181367 26 Left 1175181360 20:57149998-57150020 CCAGCGTCAGGTTGGAAAGTGAG No data
Right 1175181367 20:57150047-57150069 AGCTCTGACGGTTTGCTGAGGGG No data
1175181360_1175181362 -8 Left 1175181360 20:57149998-57150020 CCAGCGTCAGGTTGGAAAGTGAG No data
Right 1175181362 20:57150013-57150035 AAAGTGAGCCACATTACACAGGG No data
1175181360_1175181364 14 Left 1175181360 20:57149998-57150020 CCAGCGTCAGGTTGGAAAGTGAG No data
Right 1175181364 20:57150035-57150057 GTTAAACAAGACAGCTCTGACGG No data
1175181360_1175181368 27 Left 1175181360 20:57149998-57150020 CCAGCGTCAGGTTGGAAAGTGAG No data
Right 1175181368 20:57150048-57150070 GCTCTGACGGTTTGCTGAGGGGG No data
1175181360_1175181366 25 Left 1175181360 20:57149998-57150020 CCAGCGTCAGGTTGGAAAGTGAG No data
Right 1175181366 20:57150046-57150068 CAGCTCTGACGGTTTGCTGAGGG No data
1175181360_1175181365 24 Left 1175181360 20:57149998-57150020 CCAGCGTCAGGTTGGAAAGTGAG No data
Right 1175181365 20:57150045-57150067 ACAGCTCTGACGGTTTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175181360 Original CRISPR CTCACTTTCCAACCTGACGC TGG (reversed) Intergenic
No off target data available for this crispr