ID: 1175182657

View in Genome Browser
Species Human (GRCh38)
Location 20:57159583-57159605
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175182655_1175182657 -9 Left 1175182655 20:57159569-57159591 CCTGAAATATGTGGGTGAGCCCC No data
Right 1175182657 20:57159583-57159605 GTGAGCCCCATGTCATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175182657 Original CRISPR GTGAGCCCCATGTCATCACA GGG Intergenic
No off target data available for this crispr