ID: 1175187109

View in Genome Browser
Species Human (GRCh38)
Location 20:57186238-57186260
Sequence CTGTGCAGGAGTACCCGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175187105_1175187109 8 Left 1175187105 20:57186207-57186229 CCACTGAGAGGTCAGGGGAATGC 0: 1
1: 0
2: 3
3: 11
4: 167
Right 1175187109 20:57186238-57186260 CTGTGCAGGAGTACCCGGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 60
1175187101_1175187109 18 Left 1175187101 20:57186197-57186219 CCTCTGTGTTCCACTGAGAGGTC No data
Right 1175187109 20:57186238-57186260 CTGTGCAGGAGTACCCGGTAAGG 0: 1
1: 0
2: 0
3: 6
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175187109 Original CRISPR CTGTGCAGGAGTACCCGGTA AGG Intronic
902288705 1:15423044-15423066 CTGTGCAGGAGCACCTGGTGAGG - Intronic
903404276 1:23083324-23083346 CTGTGCAGGAACACCTGGTGTGG - Exonic
904730655 1:32588525-32588547 CTGAGAAGGAGTAGCCGGTGAGG + Intronic
917213689 1:172656758-172656780 GTGAGCAGGAGTGCCTGGTAAGG + Intergenic
924305979 1:242689709-242689731 CTGTGCAGGAGTCCACGGCAGGG - Intergenic
924637173 1:245799191-245799213 CTGTGTAGGAGGACCAGGGAAGG - Intronic
1075584275 10:123645798-123645820 CTGAGCAGGAGGCCCCGGAATGG - Intergenic
1077171714 11:1169272-1169294 CTGTGCAGGGGTAGGCGGTCAGG - Intronic
1077434772 11:2533669-2533691 CTGGGAAGGAGTTCCCGGTTTGG + Intronic
1077695602 11:4389996-4390018 CTGCACAGGAGTACCAGGTGAGG - Exonic
1083662642 11:64258953-64258975 CTCTGGACAAGTACCCGGTACGG + Exonic
1089329454 11:117679524-117679546 CTATGCTGGGGTACCGGGTATGG - Intronic
1104894191 12:132153798-132153820 CTGTGCAGGACTACCACGCACGG - Intergenic
1104982880 12:132581987-132582009 CTCCCCAGGAGAACCCGGTAGGG - Intronic
1107836919 13:44419454-44419476 CTTTGCAAGAATACCTGGTAAGG + Intergenic
1108610932 13:52083165-52083187 CTGTGCAGCAGAACCACGTAGGG - Intronic
1114062874 14:19037011-19037033 CTGAGCAGGAGTACACGATGAGG + Intergenic
1114099385 14:19362986-19363008 CTGAGCAGGAGTACACGATGAGG - Intergenic
1114988781 14:28262726-28262748 TTGTGCTGGAGTCCCAGGTAAGG - Intergenic
1115533205 14:34345883-34345905 CTGTGCAGGAGCCCACGGCAGGG + Intronic
1126437848 15:48654186-48654208 CTGGGCATGAGTACCCAGAAGGG - Intergenic
1128246733 15:66138121-66138143 CTGTGGAGGAGTTGCCTGTAGGG - Intronic
1138908206 16:61363873-61363895 CTGTGGAGGAGTTCCCGGATGGG - Intergenic
1140781120 16:78297825-78297847 CTGTGCAGGAGTTCCAGGGAAGG + Intronic
1147598235 17:41730437-41730459 GTGTGCAGAAGTTCCTGGTAGGG + Intronic
1150413800 17:64970277-64970299 TTGTGAAGCAGTACCCTGTAGGG - Intergenic
1151822308 17:76502939-76502961 CTCTGCAGGAGTCCCCAGGAGGG + Intergenic
1159304484 18:66622378-66622400 CTGTGCAGGATTATCTGGGATGG + Intergenic
1162149612 19:8635593-8635615 CTGTTGAGGAGTCCCTGGTATGG + Intergenic
1163712342 19:18854227-18854249 ATGTGCAGGAGCTCCCGGTGAGG + Intronic
1164743597 19:30594833-30594855 CAGTGCAGGAGGACCGGGTGTGG + Intronic
925866259 2:8229733-8229755 CTTTGCAGGGGCAACCGGTAGGG + Intergenic
926826116 2:16906551-16906573 CTTTGCAAGAGTACCTGGGAGGG - Intergenic
930621725 2:53651213-53651235 GTGTACAGGAGTCCTCGGTAAGG + Intronic
942111562 2:172687932-172687954 CTGTGCAGGGGGACTTGGTAAGG - Intergenic
947864886 2:233389755-233389777 CTGTGCCGGGGGACCCTGTAGGG + Intronic
948263607 2:236622043-236622065 TTGTGCAGGAGCACAAGGTACGG + Intergenic
1170876109 20:20251747-20251769 CCGGGCAGCAGTACCAGGTAAGG + Exonic
1175187109 20:57186238-57186260 CTGTGCAGGAGTACCCGGTAAGG + Intronic
1176004731 20:62854599-62854621 CTGTGCACGAGTTCCTGGTAGGG - Intronic
1176157143 20:63627477-63627499 CTGTGGAGGAGGACGCTGTAGGG + Intergenic
1179977720 21:44879327-44879349 CTGGTCAGGAGTACCTGATAAGG - Intergenic
1180481368 22:15759638-15759660 CTGAGCAGGAGTACACGATGAGG + Intergenic
1183284302 22:36952752-36952774 CTGAGCAGGAGCTCCCGGGAGGG + Intergenic
952754710 3:36856220-36856242 CTGCGCAGGAGGAGCCGGTGTGG - Exonic
975392809 4:73838909-73838931 CTGTGAAGGAGTAACTGGAAGGG - Intronic
976343757 4:83975520-83975542 CTGTGAAGGAGTAGGAGGTAGGG - Intergenic
986653069 5:9983684-9983706 CTGTGTAGGAGTGCCCAGCAGGG - Intergenic
996646808 5:125827041-125827063 CTGTGCAGGAGGCCCCCGTCCGG - Intergenic
999994635 5:157080554-157080576 CTGTGCAGGAACACCTGGTGTGG + Intergenic
1003958975 6:11191641-11191663 CTGTGCAGGCATACCCCATAGGG + Intronic
1007350891 6:41272705-41272727 CTTTGCCTGAGTACCAGGTATGG + Intronic
1009598175 6:65763385-65763407 TTGTGCAGGAGTACCAAGCATGG + Intergenic
1010019109 6:71139257-71139279 TTGTGCTGGAGTCCCAGGTAGGG - Intergenic
1013880199 6:114889312-114889334 CTGTGCAGGAGTATCCAGGTGGG - Intergenic
1015316991 6:131828032-131828054 GTGTGCAAGAGCACCAGGTAGGG + Intronic
1024498076 7:50070402-50070424 CAGTGCAGCAGAACCAGGTACGG - Intronic
1031889583 7:127278512-127278534 CTATGGAAGAGAACCCGGTAGGG + Intergenic
1041201223 8:55453156-55453178 CTGTGCAGGAGCACGTGGTGTGG - Intronic
1045657607 8:104403226-104403248 CTGTGCAGGAATACCCGATCAGG - Intronic
1048752621 8:137697321-137697343 TGGAGCTGGAGTACCCGGTATGG - Intergenic
1055466363 9:76570495-76570517 CTGTGCAAGAGCACCCAGTAAGG - Intergenic
1057177271 9:93009562-93009584 CTGGGCAGGAGGACCCGATTGGG + Intronic
1061163167 9:128907540-128907562 GTGTGCAGAAGCACCAGGTAGGG - Exonic
1186964417 X:14772315-14772337 CTGGGCAGGAGTTCCCTGTGGGG - Intergenic
1198256179 X:134925925-134925947 CTGTGCAGGAGCCCCAGGTGCGG - Intergenic
1201469131 Y:14314734-14314756 CTGTGCAGGAGCCCACGGTGGGG - Intergenic