ID: 1175190074

View in Genome Browser
Species Human (GRCh38)
Location 20:57205794-57205816
Sequence CAGTGCTGGCCTGTAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 172}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175190074 Original CRISPR CAGTGCTGGCCTGTAGCATC TGG (reversed) Intronic
902560864 1:17276779-17276801 CAGGGCTGGCCAGGAGCATCCGG - Exonic
903738715 1:25545664-25545686 AAGTGCTGTCCTGGAGCCTCTGG + Intronic
904303404 1:29570958-29570980 CAGTGCTGGCCTGTGCCACCTGG + Intergenic
904577488 1:31514335-31514357 CAGTGGTGGCCTGCAGGCTCAGG - Intergenic
905034593 1:34909341-34909363 CAGGGCTTCCCTGTAGGATCTGG - Intronic
907308841 1:53528057-53528079 CAGCGCTGGCTTGTGGCCTCTGG + Intronic
909599630 1:77448190-77448212 CAGGGATGGCCTGAAGCATGGGG + Intronic
911262427 1:95701956-95701978 CGGTGTTGGCCTGGAGCTTCAGG - Intergenic
912383897 1:109261851-109261873 CAGTGATGGCCAGTGGCATACGG + Exonic
915723085 1:157998255-157998277 CTCTGCTGGCATGTAGGATCTGG - Intronic
917816915 1:178720629-178720651 CAGAGCTAACCTGTAGCAGCAGG + Intergenic
917848821 1:179042989-179043011 CAGGGATGGCCTGAAGCATGGGG - Intronic
1065930236 10:30472766-30472788 AAGTGCTGAACTGTAGCATGTGG - Intergenic
1070219279 10:74423488-74423510 CAGTTTTGGCCTGGAGCACCAGG + Intronic
1070645096 10:78196292-78196314 CAGTGATGTCCAGCAGCATCAGG + Intergenic
1070921791 10:80191825-80191847 CTGAGCTGGCCTCTGGCATCCGG - Intronic
1073050777 10:100665749-100665771 CAGTGCTAGGCTAAAGCATCTGG - Intergenic
1074122308 10:110501739-110501761 CAAGGCTGGCCTGTTGCACCTGG + Intronic
1077203271 11:1325092-1325114 CAATGCTAGCGTGGAGCATCAGG + Intergenic
1078860573 11:15242892-15242914 AAGTGCAGGCCTCTAGAATCAGG - Intronic
1080178951 11:29399703-29399725 AAGTGCTGGCCAGGACCATCAGG + Intergenic
1080707250 11:34707903-34707925 CAGTGCTGCCCTGTCACAGCAGG - Intergenic
1081525012 11:43921839-43921861 CAGTTCTGGCATGTGGTATCTGG - Intergenic
1081692744 11:45089190-45089212 CAGTGCTTTGCAGTAGCATCCGG - Intergenic
1082644158 11:55701582-55701604 CTGTGCTGGCCTGGAGCTTGGGG - Intergenic
1082837389 11:57661328-57661350 CAGTGTGGACCTGGAGCATCAGG + Exonic
1084719181 11:70893150-70893172 AAGTGCTGGCCTGTAGTACTTGG + Intronic
1085435179 11:76493429-76493451 CAGGGATGGCCTGAAGCATGGGG + Intronic
1085938282 11:81176935-81176957 CAGTACTGGTCTGTAGCCTGGGG + Intergenic
1089111800 11:116063152-116063174 CAGAGCAGGCCTGCAGGATCCGG - Intergenic
1089589180 11:119529583-119529605 CAGTGCTGGCCTGTAGCTCTGGG + Intergenic
1094174743 12:27529768-27529790 CCTTGCTGGCCTGAAGAATCTGG - Intronic
1094189878 12:27687333-27687355 CTGTGCTGGCCTGTAGCAGGAGG - Intronic
1099033720 12:77560058-77560080 CAGGGATGGCCTGAAGCATGGGG + Intergenic
1099601093 12:84738755-84738777 CAGAGATGCCCTGCAGCATCAGG + Intergenic
1100841049 12:98612100-98612122 CAGTGGTTGCCTGTTGCATTAGG - Intergenic
1102543163 12:113636947-113636969 CAGTGCTGGTCTGTGGGTTCTGG - Intergenic
1103341863 12:120225060-120225082 CAGTGGGGGCCTGGAGCCTCTGG - Intronic
1105887868 13:24657860-24657882 CAATACTGGCCTTGAGCATCTGG - Intergenic
1106629495 13:31455795-31455817 CAGATGTGGCCTGTAGCAACTGG - Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1109084149 13:57949088-57949110 AAGTGCTGGCCTGTTGGGTCAGG - Intergenic
1113892403 13:113743337-113743359 CAGTGGGGGCCAGTAGAATCTGG + Intergenic
1114820251 14:26009718-26009740 CAGTGCTGCCCTGTAACAGCTGG + Intergenic
1124157324 15:27237412-27237434 CAGTCCTGGGCTGCAGGATCAGG + Intronic
1128737547 15:70061747-70061769 CACTCCTGGCCTGCAGCACCAGG - Intronic
1131921183 15:97330432-97330454 TAATGATGGCCTGTAACATCAGG + Intergenic
1132584987 16:702203-702225 CATGGCTGGGCTGTGGCATCAGG - Intronic
1133562862 16:6965914-6965936 CAGAGTTGGCATTTAGCATCGGG + Intronic
1135433170 16:22404585-22404607 CGGTACTGGCCTGTAGCCTAGGG - Intronic
1135528269 16:23230436-23230458 CAGGGCTGGCCTGGAGCTCCTGG - Intergenic
1136631024 16:31489347-31489369 CAGTGCTTGCCTGGGGCACCTGG - Intronic
1136786994 16:32940648-32940670 CAGGGCTGCCCTGCAGCGTCTGG + Intergenic
1136882780 16:33913141-33913163 CAGAGCTGCCCTGCAGCGTCCGG - Intergenic
1140263955 16:73404224-73404246 CAAGGCTGGACTGTAGCCTCTGG + Intergenic
1203089231 16_KI270728v1_random:1202318-1202340 CAGGGCTGCCCTGCAGCATCCGG + Intergenic
1144769042 17:17749000-17749022 CAGGGCTGGCATGGAGCATCAGG + Intronic
1147147343 17:38492788-38492810 CAGGGCTGCCCTGCAGCGTCGGG + Intronic
1147820144 17:43236689-43236711 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147821455 17:43244086-43244108 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147822254 17:43248571-43248593 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147823178 17:43254017-43254039 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147823547 17:43256160-43256182 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147823949 17:43258617-43258639 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147824220 17:43260218-43260240 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147824707 17:43263056-43263078 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147825864 17:43269540-43269562 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147827036 17:43276322-43276344 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147827884 17:43280882-43280904 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147828992 17:43287042-43287064 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147830088 17:43293185-43293207 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147831031 17:43298383-43298405 CCGTGCTGGGCTGTAGAATGGGG - Intergenic
1147834885 17:43322954-43322976 CCGTGCTGGGCTGTAGAATGGGG + Intergenic
1148870988 17:50658699-50658721 CAGGGCTGGCCTGTAGCCTGGGG - Intronic
1149431952 17:56601268-56601290 CATTGCAGGCCTGAAGCATCAGG - Intergenic
1150317988 17:64186019-64186041 CAATGCTGGGCTGTGACATCAGG + Intronic
1150838847 17:68589351-68589373 AAGTGCTGACCTGCAGAATCGGG + Intronic
1151054219 17:71012987-71013009 CACAGCTGGCCTGAAGCACCAGG + Intergenic
1152962029 18:85883-85905 CACTGCTGTCCTGTCCCATCTGG - Intergenic
1153033766 18:739149-739171 CAGTGGTGTCCTGTATCATACGG - Intronic
1156766946 18:40668075-40668097 CAGTTCTGCTCTGTAGCATAAGG + Intergenic
1157522037 18:48352064-48352086 GAGTCCTGGCCTGTAGGGTCAGG - Intronic
1157578414 18:48759074-48759096 CTGGCCTGGCCTGTAGCTTCAGG + Intronic
1157713429 18:49865687-49865709 CAGTTCTGGCCTGTCACAGCTGG - Intronic
1160040554 18:75341353-75341375 CAGGGCTGGCCTTGAGCATCTGG - Intergenic
1160818932 19:1049181-1049203 CAGAGCTGGGCTGTGGAATCCGG - Intronic
1163627071 19:18396391-18396413 CTGTGCTGGCCTGGAGACTCTGG - Exonic
1163691604 19:18741604-18741626 CGGAGCTGGCCTGTTTCATCTGG + Intronic
1164648406 19:29874997-29875019 CAGAGGTGGCCTGCAGCACCGGG + Intergenic
1165596913 19:37016674-37016696 CACTGCTGTCCAGTAGCAACGGG - Intronic
1167244667 19:48365746-48365768 CAGGGCTGGCCTGAAGCCCCCGG + Exonic
1167884319 19:52487919-52487941 CAGGGATGGCCCGTGGCATCTGG + Intronic
929694277 2:44100832-44100854 CAGTGCTGGCTTAAAGCATTTGG - Intergenic
931943489 2:67279261-67279283 AAGAGATGGCCTGTAGCCTCAGG - Intergenic
932416672 2:71577787-71577809 CAGTGCTGTGCTGGGGCATCAGG - Intronic
934774625 2:96929228-96929250 CAGTCCTGCCCTGTACCCTCTGG - Exonic
935533164 2:104260806-104260828 CAGTGCTGGCCTGGAAAATGGGG - Intergenic
936676473 2:114721610-114721632 CAGGGCTGATCTGTAGAATCAGG - Intronic
937289412 2:120773258-120773280 GAGCGTAGGCCTGTAGCATCCGG + Intronic
937438066 2:121895673-121895695 CAGTGCTCCCCAGCAGCATCTGG - Intergenic
937764354 2:125642065-125642087 GAGAGCTGGCCTGTGGCATGGGG - Intergenic
940132955 2:150405248-150405270 CAGTGCTGTCTTCTAGCATTGGG + Intergenic
940422828 2:153499453-153499475 CAGTGACGGCCTGAAGCATGGGG - Intergenic
941303430 2:163830867-163830889 CAGTGCTGGCCTGTTATAGCAGG - Intergenic
942209812 2:173659185-173659207 CAGTCCTGGGCTGGAGCATCTGG + Intergenic
947867404 2:233408765-233408787 CAGTGCAGGCCTGCGGGATCAGG + Intronic
948677288 2:239604233-239604255 CAGCGCTTGCCTGTAGCCTTGGG + Intergenic
1170219113 20:13923031-13923053 TGGTGGTGGCCTGTAGCAACTGG - Intronic
1174939863 20:54914286-54914308 CAGTGCTTGCATCCAGCATCAGG - Intergenic
1175190074 20:57205794-57205816 CAGTGCTGGCCTGTAGCATCTGG - Intronic
1175535212 20:59706186-59706208 CCATACTGGCCTGTAGTATCTGG + Intronic
1177809195 21:25906488-25906510 CAGTGCAGTTCTGTAGTATCTGG - Intronic
1178050633 21:28743102-28743124 CAGTGGTGGAGTGTAGCAACAGG + Intergenic
1180995159 22:19961893-19961915 CAGGGCTGGCCTTTCTCATCTGG + Intronic
1182638507 22:31748763-31748785 AAGTGCTGGCGTCTGGCATCAGG + Intronic
1185010011 22:48307546-48307568 CAGTGCTGGCGTTTAGATTCAGG + Intergenic
950496705 3:13338173-13338195 CAGTGCTGACCTGGAACAGCTGG - Intronic
951409311 3:22342913-22342935 CAGTGGTAGCCTCTAGCTTCAGG + Intronic
951656618 3:25016391-25016413 CATCGCTGGCCTGTACCCTCTGG + Intergenic
952755736 3:36864954-36864976 AATTGCTGACCTGTAGGATCAGG + Intronic
953055450 3:39383976-39383998 CAGGGCTGGCCTGCAGCTCCTGG - Intronic
957503912 3:81095171-81095193 CAGTGCTGGCTTCTAGCTCCGGG - Intergenic
960171433 3:114466051-114466073 TAGTCCTGGCCTGTAGACTCTGG - Intronic
960171532 3:114467220-114467242 TAGTCCTGGCCTGTAGACTCTGG - Intronic
963571130 3:146997561-146997583 CAGTGCTGGCCTTTAACTTCGGG + Intergenic
964211376 3:154232218-154232240 AAGTGCTGGGCTGTGGCATCTGG + Intronic
964767483 3:160192673-160192695 CAGTGGTGGCCTGGAACAGCTGG + Intergenic
965009817 3:163073379-163073401 CAGTGATGGCCTGAAGCATGGGG + Intergenic
968800176 4:2738058-2738080 CAGCGGAGGCCTGTAGGATCTGG + Intergenic
970617260 4:17780252-17780274 CAGGTCTGTCCTGTAGCGTCTGG - Intronic
971876837 4:32318898-32318920 CAGGGATGGCCTGAAGCATGGGG - Intergenic
973664756 4:53147646-53147668 TAGGGCTGCCCTGTAGCTTCAGG + Intronic
974178965 4:58360463-58360485 CAGTGATGGCCTGAAGCCTGGGG - Intergenic
975443654 4:74439097-74439119 CAGTGCTGGGTTTTAGCCTCAGG + Intergenic
976272744 4:83247574-83247596 CCGTGCTGGCCTGTAGCACCTGG - Intergenic
976480798 4:85542449-85542471 CAGGGCTGGCCTGTGGCAAGGGG - Intronic
980279250 4:130697894-130697916 CAGTGCTCCCTTGGAGCATCTGG - Intergenic
980582711 4:134774219-134774241 CAGGGATGGCCTGAAGCATCAGG + Intergenic
985084305 4:186297414-186297436 CAGCGCCGTCCTGGAGCATCTGG - Intergenic
986638318 5:9847030-9847052 CAGAGCTGGGCTGTAGCTTTGGG - Intergenic
988324269 5:29741591-29741613 AAGTGCTGGCCAGAGGCATCAGG + Intergenic
990046144 5:51434201-51434223 CAGTGCTGGCTCCTAGGATCTGG - Intergenic
991039675 5:62162596-62162618 CAGGGCTGACCTGAAGCCTCGGG - Intergenic
992613666 5:78529540-78529562 CAAGGCTGGCATGTAGCATACGG + Intronic
994416473 5:99477851-99477873 CAGAGCAGGCCTGGAGCATATGG - Intergenic
994451563 5:99950605-99950627 CAGTGATGGCCTGAAGCCTGGGG + Intergenic
994463495 5:100097322-100097344 CAGAGCAGGCCTGGAGCATATGG + Intergenic
995557428 5:113344161-113344183 CAGTGCTGCCCTGTCACAGCAGG + Intronic
995927010 5:117386419-117386441 CAGGGATGGCCTGAAGCCTCGGG + Intergenic
996321448 5:122222040-122222062 CTGTGCTGCTCTGTAGCATATGG + Intergenic
997002934 5:129784115-129784137 CAGTGCTGTCCTGTCACAGCAGG + Intergenic
1001068506 5:168560931-168560953 CAGTGCTGCCTTGTTGCATATGG - Intronic
1001542724 5:172550676-172550698 CAGTCCTGGCTTGTGTCATCTGG + Intergenic
1004357206 6:14940344-14940366 TAGTGCTTGCCTGTAGTCTCAGG + Intergenic
1005503800 6:26452375-26452397 CAGTGCGTGCCTGTAGCTTATGG - Exonic
1007245726 6:40460785-40460807 CAGTGCTGTCCTCAAGCAGCTGG - Intronic
1007433094 6:41787595-41787617 CACTGCCGGCCGGTAGCAGCCGG + Intronic
1008927347 6:56900916-56900938 CACTGCTTGACTGAAGCATCAGG + Intronic
1010813821 6:80331162-80331184 CAGTCATGGCCTTAAGCATCCGG + Intronic
1015949162 6:138533986-138534008 CATTAATGGCCTGTAGCATGTGG - Intronic
1015961289 6:138651686-138651708 CATTTCTGTCCTGTAGCTTCTGG - Intronic
1018710254 6:166493767-166493789 CAGTGGACGCCTGTAGCACCAGG - Intronic
1019879029 7:3842146-3842168 CAGGGCTGGCCTGAATCACCAGG + Intronic
1021244328 7:18243470-18243492 CAGTGATGACTTGTAGCCTCTGG + Intronic
1022837493 7:34131624-34131646 AAGTGAAGGCCTCTAGCATCTGG - Intronic
1024505196 7:50156780-50156802 CAGTGCTGGCCTCTCCCAGCTGG + Intronic
1028334583 7:89636292-89636314 CTGTGCTGGGTTGTAGCCTCTGG - Intergenic
1040593958 8:48819999-48820021 CAGAGCTGGACTCCAGCATCAGG + Intergenic
1040711017 8:50188829-50188851 CAGTGCAGGCCTTTAGGATTTGG - Intronic
1041244623 8:55879126-55879148 CAGTGCTTGCACGTAGCAGCTGG - Intergenic
1041705699 8:60844150-60844172 CAGTGCTGTGCTGTCTCATCTGG - Intronic
1043303424 8:78763118-78763140 CAGTGCTTGTGTGCAGCATCTGG - Intronic
1048409677 8:134159485-134159507 GATTGCTGGCCTTCAGCATCAGG - Intergenic
1048837376 8:138533413-138533435 CAGTGCTGGCAGGTAGGATAGGG + Intergenic
1050947940 9:11549778-11549800 CAGGGATGGCCTGAAGCATGGGG + Intergenic
1051138271 9:13949263-13949285 CGGTGCTGGCGTGTAGCTCCTGG - Intergenic
1053018222 9:34676171-34676193 CAGGGCTGGGCTGTAGTAGCAGG + Intergenic
1056890758 9:90489478-90489500 CAGTGCAGGCTGGTAGCAGCTGG - Intergenic
1058387483 9:104455350-104455372 CAGTGCTGACCAGATGCATCTGG - Intergenic
1060521204 9:124295068-124295090 CAGGGTGGGCCTGCAGCATCAGG - Intronic
1060986818 9:127824860-127824882 CAATGCTGGCATTGAGCATCCGG + Exonic
1061734060 9:132640351-132640373 CAGTCCTGGAATGTATCATCTGG - Intronic
1061916550 9:133758367-133758389 CAGTGCTGGCTTCTGGCCTCGGG + Intergenic
1062249313 9:135586329-135586351 CAGTCCTGCCCTGGAGCCTCCGG + Intergenic
1189259596 X:39669064-39669086 CAGTGCTGCCCTGTGGGATCAGG + Intergenic
1191784624 X:64903999-64904021 CATTTCTGGACTGTAGCATTTGG - Intergenic
1192380680 X:70613429-70613451 CAGTGCTGCCCTGTCACAGCAGG + Intronic
1193294189 X:79814993-79815015 AAGTCCTGGCCTGTACAATCAGG - Intergenic
1194763726 X:97824920-97824942 CAGTGATTGCCCGTAGCATTAGG - Intergenic
1199350106 X:146790423-146790445 CAGTGCGGACATGTACCATCAGG + Intergenic