ID: 1175190107

View in Genome Browser
Species Human (GRCh38)
Location 20:57206049-57206071
Sequence CCGAGCTGTCAGACTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175190107_1175190116 26 Left 1175190107 20:57206049-57206071 CCAGGTCCAGTCTGACAGCTCGG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1175190116 20:57206098-57206120 TGAGCATCGTAAAAGAACACTGG 0: 1
1: 0
2: 0
3: 7
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175190107 Original CRISPR CCGAGCTGTCAGACTGGACC TGG (reversed) Intronic
901000718 1:6147576-6147598 CGGTGCTGTCTGACTGGACAGGG + Intronic
907074204 1:51564128-51564150 GAGTGCTGTCAGGCTGGACCTGG + Intergenic
911058788 1:93730284-93730306 CCGAGCTCTCTGACAGTACCTGG + Intronic
915022701 1:152796653-152796675 CCCAGCTGTGAGACAGGGCCTGG - Intronic
920391087 1:205602268-205602290 CACAGCTGGCTGACTGGACCAGG - Exonic
921121706 1:212143056-212143078 CCTAGCTGTCAGTCAGGGCCTGG + Intergenic
923036552 1:230288587-230288609 CACAGCAGTCAGACTGGATCAGG - Intergenic
1076943145 10:133623232-133623254 CCGAGCTCTCGGCCTGCACCGGG + Intergenic
1079116745 11:17645056-17645078 CATAGCTATCAAACTGGACCAGG - Intronic
1083144635 11:60749191-60749213 CAGAGCTGGGAGGCTGGACCCGG - Intergenic
1085777312 11:79378494-79378516 CCCAGGTGACAGTCTGGACCGGG - Intronic
1086539574 11:87892153-87892175 CCAGGCTGTCAGACTGCACATGG - Intergenic
1091204689 11:133812025-133812047 CCGAGCTGTCTGTGTGGGCCCGG - Intergenic
1091602795 12:1928195-1928217 GCAAGCTGCCAGCCTGGACCAGG - Intergenic
1096978985 12:55717669-55717691 CCGAGCTGTTCTACTTGACCTGG - Intronic
1110721041 13:78762302-78762324 TCCAGCAGTCAGACTGGACTAGG + Intergenic
1111542437 13:89686875-89686897 AAGGGCTGTCAGACTGCACCTGG + Intergenic
1113489905 13:110683050-110683072 CCTGGCTCTCCGACTGGACCAGG + Exonic
1117793085 14:59361621-59361643 TCAGGCTGGCAGACTGGACCTGG + Intronic
1123134377 14:106013371-106013393 GAGACCTGTCAGACAGGACCAGG - Intergenic
1133595499 16:7287298-7287320 ATGAGCTGTCACACAGGACCTGG + Intronic
1141910589 16:87056090-87056112 CCTACCTGTCAGACAGGACTTGG + Intergenic
1142478217 17:202210-202232 CCGAGCTGTCAGCTTAGACTTGG + Intergenic
1144088747 17:11834469-11834491 CTGCGCTGTCAGATGGGACCAGG - Intronic
1146340703 17:32017512-32017534 CTGAGCTGTGAGACCGGACATGG + Intronic
1146722167 17:35131159-35131181 CTGTGCTCTCAGACTGCACCAGG - Intronic
1147258954 17:39197596-39197618 CCGAGCTGGGTGGCTGGACCGGG - Exonic
1150626367 17:66843783-66843805 GCCAGCTGTCAGCCTGGTCCTGG + Intronic
1151161987 17:72173753-72173775 CAGAGCTGTCGGAATGGTCCTGG + Intergenic
1152891260 17:82882910-82882932 CCGCGCTGCCAGGCTGGAGCGGG + Intronic
1160691895 19:464083-464105 CCGGGCTGTCGTACTGGCCCGGG + Exonic
1160732736 19:648621-648643 CCGGGCTGCCAGAGGGGACCTGG + Intronic
1164886030 19:31779489-31779511 CCCAGGTGTCAGCCTGCACCAGG + Intergenic
1165460441 19:35940796-35940818 CCGAGCTGTTGTACTGGATCTGG - Exonic
926963767 2:18387590-18387612 AAGAGCTGTCAGCCTGGTCCAGG + Intergenic
929594555 2:43168166-43168188 CCCTGGTGTCAGACAGGACCTGG + Intergenic
932573586 2:72950931-72950953 CCGAGCTGGCTGCCTGGGCCTGG - Intronic
945116261 2:206410864-206410886 CCGAGCTGCCAGCCTGCAGCTGG + Intergenic
1168906299 20:1406542-1406564 CCTTGCTGTCAGAGTGGCCCAGG - Intergenic
1173017043 20:39235079-39235101 CCGCACTGTCAGAGTGGTCCTGG + Intergenic
1173919255 20:46731571-46731593 GCGGGGTGTCAGCCTGGACCTGG + Intronic
1175190107 20:57206049-57206071 CCGAGCTGTCAGACTGGACCTGG - Intronic
1179609610 21:42541364-42541386 CAGAGCTGCCAGGCTGGCCCAGG + Intronic
1179609625 21:42541433-42541455 CGGAGCTGCCAGGCTGGCCCTGG + Intronic
1183729405 22:39609307-39609329 CCCAGCAGTCACACTGAACCAGG - Intronic
951064321 3:18246674-18246696 ACGACCTGTTAGACTGGGCCAGG + Intronic
959525546 3:107372520-107372542 CAGAGCTGTTGCACTGGACCAGG - Intergenic
961723185 3:128909275-128909297 CCGGGCTGTGAGACAGGACAGGG + Intronic
963920089 3:150897063-150897085 CTGACCTGTCAGAGTGGACAAGG + Intronic
967447441 3:189583359-189583381 GCGAGATAGCAGACTGGACCAGG - Intergenic
968528142 4:1075057-1075079 CACAGCTGTCAGACAGCACCAGG - Intronic
968868027 4:3226232-3226254 CCGAGCTGTCTGCCTGCACACGG - Intronic
969239230 4:5888304-5888326 CGGGGCTGTCTGACTGGAACCGG + Intronic
969560611 4:7945064-7945086 CAGAGCTGTCATACTGTGCCTGG - Intergenic
969912326 4:10457664-10457686 CCGGGATGGCAGACTGGGCCAGG - Intergenic
970500422 4:16671514-16671536 CTGAGCTGCTGGACTGGACCAGG - Intronic
978065503 4:104394725-104394747 TCGAGCTGTCTGTCTGCACCAGG - Intergenic
985446498 4:190023674-190023696 CCGAGCTCTCGGCCTGCACCGGG + Intergenic
985514789 5:335944-335966 CTGAGGTGTGAGAGTGGACCAGG - Intronic
987928137 5:24367574-24367596 GCCAGCTGCCAGACTGAACCTGG + Intergenic
996522118 5:124438598-124438620 CCGAGATGTCACCCTGGCCCGGG - Intergenic
998392137 5:141794078-141794100 CCGGCCTGGCAGCCTGGACCAGG - Intergenic
1002332669 5:178455312-178455334 CCCAGCTGTCACTCTGCACCAGG - Intronic
1004441494 6:15659473-15659495 CAGAGCTATCACATTGGACCTGG - Intronic
1012921384 6:105224060-105224082 CTGAGCTGTCAGACTGGCCAGGG + Intergenic
1018837632 6:167497115-167497137 CCAGGCTGTCAGCCTGGAACAGG - Intergenic
1020032048 7:4940253-4940275 CTGAGCTCTGAGACTGGGCCTGG - Intronic
1020781306 7:12519464-12519486 GAGAGCTGTCTGACTGGAGCTGG - Intergenic
1021948813 7:25754243-25754265 CCGAGCTTTCTGGCTGGACTGGG + Intergenic
1022156698 7:27667751-27667773 CAGAGCTGTCAAACTGGCCCTGG - Intergenic
1034147124 7:148883803-148883825 TCGAGCTGCCACCCTGGACCGGG + Intronic
1040396306 8:47003699-47003721 CCGACCTGTCAGCCAGGACCAGG + Intergenic
1047458386 8:125037903-125037925 GCCAGCTGGCAGTCTGGACCTGG - Intronic
1049940112 9:537330-537352 ACCAGCTGTCAGACAGGAACTGG - Intronic
1050758281 9:9034929-9034951 CCAAGATTTCAGACTGCACCAGG - Intronic
1051818728 9:21139798-21139820 CTGAGCTGTCCTACTGAACCTGG - Intergenic
1053173302 9:35906036-35906058 AGGAGCTGTCAGGCTGGATCTGG - Intergenic
1055639879 9:78311249-78311271 CCGAGATGTCAGGCTGCACATGG + Intronic
1061389463 9:130309596-130309618 CCCAGATCTCAGCCTGGACCTGG + Intronic
1192538722 X:71950214-71950236 CCGAGCTGTCCATCTGGCCCAGG + Intergenic