ID: 1175190289

View in Genome Browser
Species Human (GRCh38)
Location 20:57207362-57207384
Sequence CTGTAGTCACTGATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175190289 Original CRISPR CTGTAGTCACTGATGGAGCT AGG (reversed) Intronic
901758423 1:11455418-11455440 CTGAAGCCAGTGGTGGAGCTTGG + Intergenic
901770607 1:11528695-11528717 CTGTGGTCTCTGACGGGGCTCGG + Intronic
902775078 1:18669463-18669485 CGGCAGTCAGTGAGGGAGCTGGG - Intronic
905421796 1:37851717-37851739 CAGTAATCACTGATGGAGGATGG + Intronic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
905925502 1:41746700-41746722 CAGCAGACACTGTTGGAGCTTGG + Intronic
907041346 1:51263263-51263285 GTTTAGTCACTGATGGACATGGG - Intronic
908960634 1:69692963-69692985 CTCTGCTCACTGCTGGAGCTGGG + Intronic
916474551 1:165156384-165156406 GTGTAGTCACTCAGGGAGCCAGG + Intergenic
917941704 1:179928612-179928634 TGTTAGTAACTGATGGAGCTAGG + Intergenic
920872709 1:209807185-209807207 CTGTAGTAACTGATGGAGTTGGG - Intergenic
922641276 1:227234312-227234334 CTGTACTCTCTGAGGCAGCTTGG - Intronic
922841971 1:228650169-228650191 CTGCAGCCGCTGATGGAACTAGG - Intergenic
923116028 1:230938616-230938638 CTGTGGTCTCTCAAGGAGCTGGG + Intronic
924728234 1:246689759-246689781 CTGCAGTCACTGTAGGAGCGGGG - Intergenic
924945836 1:248846495-248846517 CTGAAGTTACTGAAGGGGCTGGG - Intronic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1064604825 10:17028066-17028088 CGATAGTCACTGATGGAGCAAGG + Intronic
1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG + Intronic
1070993319 10:80752127-80752149 CCTTAGTCACTGCTGGAGGTGGG + Intergenic
1071519441 10:86319905-86319927 CTGCTGTCACCGAGGGAGCTAGG - Intronic
1072345842 10:94505256-94505278 ATGAAATCACTGATGGAGCCAGG + Intronic
1072515436 10:96176960-96176982 CTGCAGCCACTGAAGTAGCTGGG - Intronic
1076115107 10:127890033-127890055 CTGCACTCACTGCTGGAGCATGG - Intronic
1077661135 11:4069541-4069563 CTGAAGTCACTGTAGGAACTAGG - Intronic
1078526512 11:12105596-12105618 CTGCTGTAACTGATGGATCTTGG - Intronic
1079513229 11:21235501-21235523 CTATAGAGACTGATGGAGCGGGG + Intronic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1081208084 11:40298408-40298430 CTATAGTCACTGGTGCAACTGGG + Intronic
1082789100 11:57335286-57335308 CTGTGCTCACGGATGGAGCCAGG + Intronic
1085769679 11:79313722-79313744 CTGTTGTCACTGCTGGAGCTCGG - Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1087335817 11:96843004-96843026 CTGAAGTCAATGAGGGAGCATGG - Intergenic
1088201233 11:107337508-107337530 CTGTAGTACAGGATGGAGCTAGG + Intronic
1089657327 11:119959634-119959656 ATACAGTCACTGATGAAGCTAGG + Intergenic
1090033952 11:123231903-123231925 CTGAAGTGACTGATGGAGGCAGG - Intergenic
1091848189 12:3673874-3673896 CAGCAGTCACTGATGGAGTCAGG + Intronic
1093658450 12:21724772-21724794 CTGATTTCTCTGATGGAGCTGGG + Intronic
1093707221 12:22287993-22288015 CTTCAGACACTGAGGGAGCTGGG - Intronic
1098051236 12:66455516-66455538 CTGTATGCACTCATGGAGGTAGG + Exonic
1098389667 12:69956221-69956243 AGGTAGTAAGTGATGGAGCTGGG + Intronic
1098614636 12:72507910-72507932 TTTTAGCCACTGCTGGAGCTAGG - Intronic
1099406979 12:82276007-82276029 CTGTAGTAAGTGGTAGAGCTAGG + Intronic
1099985545 12:89658692-89658714 CTTTAGTCACTGATTGACCCAGG - Intronic
1101506662 12:105353180-105353202 CTGTAGTCACAGCTGGATCCAGG + Intronic
1101695126 12:107118567-107118589 CTGTGATCACTGATGGTGCTGGG - Intergenic
1103019426 12:117522110-117522132 CTGTAGGCAGTTATGGCGCTTGG + Intronic
1105434238 13:20363177-20363199 CCGTAGTCACTGCCCGAGCTGGG - Intergenic
1105636315 13:22219003-22219025 CTGGAGTCACTGCTGAATCTTGG + Intergenic
1108556831 13:51601700-51601722 ATGTAGAAACTGATGCAGCTAGG + Intronic
1110708173 13:78619478-78619500 CAGAAGTCACTGATGGAGTTAGG + Intronic
1111420608 13:88005650-88005672 ATCTAGCCACTGGTGGAGCTGGG - Intergenic
1111862961 13:93731185-93731207 CTGTAGTCAGTGATAGTGCTAGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115039885 14:28910563-28910585 AACTAGTTACTGATGGAGCTGGG + Intergenic
1115854780 14:37619227-37619249 GTCTAGTCAGTCATGGAGCTAGG + Intronic
1117263334 14:54059647-54059669 CTATAGCCTCTGATGGATCTGGG - Intergenic
1118757462 14:68855368-68855390 TTGTGATCACTGATGGGGCTCGG - Intergenic
1119083376 14:71717928-71717950 CTGTAGGTACTGATGTAACTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120723680 14:87915198-87915220 CTGGAGTCACTGAAAGAGATGGG - Intronic
1121632092 14:95428837-95428859 CTGAAGCCACTGACGTAGCTGGG + Intronic
1122268188 14:100556478-100556500 CTGTAGTCACTCCTGGACCTTGG + Intronic
1123134182 14:106012106-106012128 CAGTAGTAACTGGTGGAGTTGGG - Intergenic
1123222874 14:106872935-106872957 CAGTGGTAACTGGTGGAGCTGGG - Intergenic
1123584213 15:21742548-21742570 CAGTAGTAACTGGTGGAGCTGGG - Exonic
1123620864 15:22185151-22185173 CAGTAGTAACTGGTGGAGCTGGG - Intergenic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128268221 15:66285785-66285807 CTGCAATCACTTCTGGAGCTTGG - Intergenic
1128502320 15:68235242-68235264 GTGTAGTCACAGGTGGACCTGGG + Intronic
1130043501 15:80426261-80426283 CTTTGGTCACAGAAGGAGCTAGG - Intronic
1130660035 15:85824106-85824128 CTGCAGTCCCTGGAGGAGCTGGG + Intergenic
1130897934 15:88184983-88185005 CTGAAGTCTCAGATGAAGCTAGG - Intronic
1131487960 15:92837795-92837817 CTGTTGTCACTGATGTTGATCGG - Intergenic
1131902875 15:97107927-97107949 CTGGAGTCCCTGAAGGAGATGGG + Intergenic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1143033953 17:3983822-3983844 CTGAAGTCACTGCAGGAGGTCGG + Intergenic
1143141203 17:4742742-4742764 CTGCAGTTAGTGGTGGAGCTGGG - Intronic
1144956062 17:19019528-19019550 CTGCAGTCACTGGTGGGGCCAGG - Exonic
1146258147 17:31403700-31403722 CTTGAGTAACTGGTGGAGCTGGG + Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1147343570 17:39771174-39771196 CTGAAGTCACTGCTGGTGGTGGG - Intronic
1147605648 17:41772386-41772408 CTGGAGTCTCTGAGGGAGCCTGG - Intronic
1148445592 17:47735082-47735104 CTGTTGTCATTGGTGGACCTGGG + Intronic
1149388606 17:56167713-56167735 ATGTAGTCACTCAGGGACCTAGG + Intronic
1149928977 17:60730939-60730961 CTGTGGCCACTCATGTAGCTAGG + Intronic
1150865264 17:68842514-68842536 CTGTGGTCAATGATAGAGGTAGG + Intergenic
1151841243 17:76619322-76619344 CTCTATTCACTGACGGATCTAGG + Intergenic
1152085112 17:78213363-78213385 CTGGAGTCACTTCTGGAGCTGGG - Intergenic
1152201630 17:78950554-78950576 CATGTGTCACTGATGGAGCTGGG - Intergenic
1153171185 18:2317897-2317919 CTGTAGTTACTCAAGGGGCTGGG - Intergenic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1156996303 18:43471898-43471920 CAATTGTCACTGATGGAGCCAGG + Intergenic
1157142611 18:45125198-45125220 TTGTAATCTCTGAGGGAGCTTGG + Intergenic
1157313646 18:46570988-46571010 GTGTAGTCAGTGATGGGGCTGGG - Intronic
1159283377 18:66316769-66316791 CTGTAATCACTGTTGAAGCTTGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1161079567 19:2303790-2303812 CTGTGGCCAATGATGGAGCATGG + Intronic
1162340880 19:10091115-10091137 GTGAAGTCACTGATTGAGTTGGG + Intronic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1166939079 19:46352063-46352085 CTGGAGCCACTCATGGAGCCTGG + Intronic
1167237665 19:48325066-48325088 CTGCTTTCCCTGATGGAGCTTGG - Intronic
1167794781 19:51702348-51702370 CTGTAGGCCCTGATGGGGATGGG - Intergenic
925500913 2:4503732-4503754 CTGTAGTTACAGTTGGTGCTTGG - Intergenic
926460055 2:13117957-13117979 CTGTAGTTAGAGATGGAGCCTGG - Intergenic
927871782 2:26628665-26628687 CTGCAGCCACTCCTGGAGCTGGG + Intronic
928444789 2:31323601-31323623 CTGTATTCAATCATGGAGATTGG + Intergenic
928692885 2:33819396-33819418 CTTTAGTCACTGAAAGGGCTTGG - Intergenic
930713473 2:54571287-54571309 GTGAAGTCACTGGTAGAGCTAGG - Intronic
931747335 2:65301583-65301605 CCATAGTTACTGATGGAGCATGG + Intergenic
931924798 2:67060334-67060356 CTATAGCCACTGATGGAGGTGGG - Intergenic
932355431 2:71064607-71064629 CTGGAGTCACGGAGGGAGCCAGG - Intronic
936434254 2:112489980-112490002 CAGTATTCACTGATGGAGAAGGG - Intronic
936530634 2:113274690-113274712 CTGTAATTATTGATGGAGTTGGG - Intronic
937452365 2:122012219-122012241 ATGTGGCCACTGGTGGAGCTGGG + Intergenic
939319568 2:140600336-140600358 ATGTAATGACTCATGGAGCTTGG - Intronic
939627101 2:144491144-144491166 ATGGAGTCTCTGAAGGAGCTGGG + Intronic
940081296 2:149805040-149805062 CTGTATTAACTGAGGAAGCTAGG + Intergenic
941934138 2:170970218-170970240 CTGCAGCCATTGATGGAGGTGGG + Intergenic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
945853173 2:215034487-215034509 TTTTAGTCACTGATGGAGCTTGG - Intronic
946403658 2:219481872-219481894 CTCTAATCAGTGATGGAGTTGGG + Intronic
1169731482 20:8790006-8790028 CTGTAGTAAGTGTTGAAGCTAGG - Intronic
1170063808 20:12288703-12288725 CTGGGGTCACTTATGCAGCTTGG - Intergenic
1171950893 20:31420729-31420751 CTGTAGTCACTGCTGTGGTTTGG - Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1180022542 21:45137602-45137624 CTGCGTTCAGTGATGGAGCTTGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181258124 22:21577570-21577592 CTGAAGTCAGTGGTGGAGCCAGG + Intronic
1184981122 22:48096713-48096735 CTGGAGTCGCGGATGGACCTGGG - Intergenic
1185185038 22:49393895-49393917 CTGTAGTTAGTGAAGGAGCCAGG + Intergenic
950676689 3:14558441-14558463 CCAAAGGCACTGATGGAGCTAGG - Intergenic
951988050 3:28642919-28642941 CCATAGTAAGTGATGGAGCTAGG + Intergenic
954878571 3:53819184-53819206 CTGTAATCACTCGTGGAGGTGGG - Intronic
956663110 3:71618483-71618505 CTCTAGTCACAGATGGATCATGG - Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
959938365 3:112054226-112054248 CTCTAGTCAGTGATGGTGATAGG - Intronic
960343981 3:116509796-116509818 ATATAGCCACTGATGGAGCTTGG + Intronic
961311850 3:126007383-126007405 CTCTAGCCACTGCTTGAGCTCGG - Intronic
964274629 3:154996474-154996496 CAGTACTCAGTGATAGAGCTAGG - Intergenic
965109216 3:164400750-164400772 CTGTAGTCACTGATAGCGTGAGG + Intergenic
965684763 3:171290338-171290360 CTGTAGTTAATGATGGTGGTAGG - Intronic
968275717 3:197438700-197438722 CTGCTGTCAATGATGAAGCTGGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969466417 4:7359725-7359747 CTGTAGGCATTAATGTAGCTGGG + Intronic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
973632740 4:52834679-52834701 CTGCAGTCAGTGGTGGAACTGGG + Intergenic
975081889 4:70291245-70291267 CTCTAGTGACTGATGGACATGGG + Intergenic
975098207 4:70481635-70481657 CTGTGGTCTCTTGTGGAGCTGGG - Exonic
975860236 4:78669370-78669392 CTGCAGTTTTTGATGGAGCTAGG - Intergenic
977155696 4:93570196-93570218 CAGTAGCCAGTGGTGGAGCTGGG + Intronic
977238989 4:94543589-94543611 TGGTGGTCACTGATGGAGGTGGG - Intronic
977806641 4:101307271-101307293 CTGTAATCACAAGTGGAGCTAGG - Intronic
985990550 5:3556805-3556827 CTGGAGCCCCTCATGGAGCTTGG + Intergenic
986684430 5:10263730-10263752 CTGTAGCCACTTGTGTAGCTCGG + Intronic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
987456281 5:18151043-18151065 CTGGAGCAACTTATGGAGCTGGG - Intergenic
991324570 5:65416195-65416217 TTGTAGTCACAGCTGGAGCCTGG - Intronic
993404689 5:87496738-87496760 CTGTATTCAATAATGGTGCTGGG + Intergenic
993516264 5:88839094-88839116 CTGTAGGCTCTGATAGAGCAAGG - Intronic
993933605 5:93973062-93973084 CTTTAGCCACTGAAGCAGCTGGG + Intronic
997223151 5:132187066-132187088 CAGTAGGCACCGTTGGAGCTGGG - Intergenic
997231920 5:132251615-132251637 CTTTAGTCACTGATTGGTCTTGG - Intronic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
998930877 5:147180417-147180439 AAGTAGTAAATGATGGAGCTGGG + Intergenic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
999430393 5:151520728-151520750 AGCTAGTGACTGATGGAGCTAGG + Intronic
999739260 5:154537516-154537538 CTCTAGTCACTGCTGTACCTTGG - Intergenic
999805481 5:155077298-155077320 CTTTAGTGACAGATGGAGCATGG - Intergenic
1003978575 6:11367751-11367773 CTGCTGTCAATGATTGAGCTAGG - Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005925927 6:30445618-30445640 AGGCAGTCACTCATGGAGCTAGG + Intergenic
1007040054 6:38713729-38713751 CTTTTGGCACTGATGGAGCTGGG - Intergenic
1011685952 6:89823682-89823704 CTGTAGTCTCTGGAGTAGCTGGG + Intergenic
1011821873 6:91262442-91262464 ATGCACACACTGATGGAGCTGGG + Intergenic
1012319314 6:97823259-97823281 CTGTAGTCTTTGATGGTGCCAGG + Intergenic
1013887267 6:114984516-114984538 CAGTAGTCACTGCTGGGGTTGGG + Intergenic
1016501889 6:144729632-144729654 CAGCAGTCACTGAAGGAGTTTGG + Intronic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1021719442 7:23491337-23491359 TTGTAGTCACAGCTGGAGCCTGG - Intergenic
1022488384 7:30797978-30798000 CTGGAGGCACTGAAGGACCTGGG + Intronic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1028658709 7:93241299-93241321 CACTGGTCACTGATGGAGCTAGG - Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1030957756 7:115876552-115876574 ATGCAGTCACTGCTGGAGCCTGG - Intergenic
1033524575 7:142197536-142197558 CTGTACTCACTCATGGAGAAGGG - Intronic
1034080557 7:148274181-148274203 CTGTAGTCACAGAGGGACCCAGG - Intronic
1035323201 7:158047520-158047542 CTGCAGTCACTGAGGGTGCGAGG + Intronic
1038865820 8:31437839-31437861 TTGTAGTCACTTGTGGAACTGGG - Intergenic
1039026706 8:33266765-33266787 CATTAGTCAATGAGGGAGCTGGG - Intergenic
1039811137 8:41049277-41049299 CTGCAGTCACTGTGGGAGATGGG - Intergenic
1041675142 8:60530706-60530728 TTGTAATCACTGATGGATTTGGG + Intronic
1041897504 8:62942641-62942663 CTATAGTCACTGAAGCAGCATGG + Intronic
1042826161 8:72981885-72981907 ATCTAGTAAGTGATGGAGCTAGG - Intergenic
1047565092 8:126035207-126035229 GTGAAGACACTGATGAAGCTGGG - Intergenic
1049351125 8:142165363-142165385 GTGTGGTCACTGAAGGAGCCAGG - Intergenic
1050243086 9:3658788-3658810 CTGCAGTCACTGCTGTAGCCAGG - Intergenic
1050571615 9:6945706-6945728 CAATAGTAACTGATTGAGCTTGG + Intronic
1051680480 9:19602707-19602729 AGGTAGAAACTGATGGAGCTGGG - Intronic
1052124048 9:24754112-24754134 AGCTAGTTACTGATGGAGCTAGG - Intergenic
1053472413 9:38356442-38356464 CTCTAGTCACTGAGGGACCTTGG - Intergenic
1057019650 9:91686592-91686614 CTATGGTCACTGATGGGGGTAGG - Intronic
1058291876 9:103252671-103252693 GTGTAGTCACTGAAGGAATTAGG - Intergenic
1059152028 9:111957521-111957543 CTGTAGTCAATGACTGAGCACGG + Intergenic
1059310488 9:113385621-113385643 CTAAAGTCACTCTTGGAGCTGGG - Intergenic
1059711321 9:116870210-116870232 CTGAAGTCAGTGTTGGAGTTAGG + Intronic
1060287830 9:122269939-122269961 ATTTAGTCAGTAATGGAGCTAGG + Intronic
1061796315 9:133087664-133087686 CTGCAGTCAGAGAGGGAGCTGGG + Intergenic
1185918319 X:4061391-4061413 CTGGTCTCACTGTTGGAGCTGGG - Intergenic
1186543224 X:10422258-10422280 TTGTAGTTTGTGATGGAGCTGGG + Intergenic
1187173786 X:16876543-16876565 CAGTAGTCATTGATGGAGGAAGG - Intergenic
1187280780 X:17857305-17857327 CTGGAGCCACCGAGGGAGCTGGG - Intronic
1190437458 X:50439824-50439846 CTGTAGACACTCATAGTGCTAGG + Intronic
1192001510 X:67156824-67156846 CTCTAGGAAGTGATGGAGCTAGG - Intergenic
1192608622 X:72545499-72545521 AGGTAGTAATTGATGGAGCTGGG + Intronic
1195174793 X:102305190-102305212 CTGTAGTGACTGGAAGAGCTGGG - Intergenic
1195184072 X:102381903-102381925 CTGTAGTGACTGGAAGAGCTGGG + Intronic
1195468388 X:105206393-105206415 GGGTAGTAAATGATGGAGCTGGG + Intronic
1195475340 X:105278752-105278774 CCATAGTAAGTGATGGAGCTAGG + Intronic
1196236773 X:113290920-113290942 CTGTAATGACTAATGGTGCTGGG + Intergenic
1198492178 X:137152764-137152786 CTGTAGGGACTCAGGGAGCTAGG + Intergenic