ID: 1175190887

View in Genome Browser
Species Human (GRCh38)
Location 20:57211493-57211515
Sequence TACCCACAGCTTCCTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 195}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175190887_1175190896 13 Left 1175190887 20:57211493-57211515 CCTGACCCAGGAAGCTGTGGGTA 0: 1
1: 0
2: 0
3: 29
4: 195
Right 1175190896 20:57211529-57211551 GCCCTGATCCCAGAAGCTGTGGG 0: 1
1: 0
2: 2
3: 17
4: 178
1175190887_1175190890 -9 Left 1175190887 20:57211493-57211515 CCTGACCCAGGAAGCTGTGGGTA 0: 1
1: 0
2: 0
3: 29
4: 195
Right 1175190890 20:57211507-57211529 CTGTGGGTATGCCACCTCCCAGG 0: 1
1: 0
2: 1
3: 16
4: 184
1175190887_1175190895 12 Left 1175190887 20:57211493-57211515 CCTGACCCAGGAAGCTGTGGGTA 0: 1
1: 0
2: 0
3: 29
4: 195
Right 1175190895 20:57211528-57211550 GGCCCTGATCCCAGAAGCTGTGG 0: 1
1: 0
2: 1
3: 17
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175190887 Original CRISPR TACCCACAGCTTCCTGGGTC AGG (reversed) Intronic
901229583 1:7634347-7634369 TTCCCACAGCTGCCCAGGTCTGG - Intronic
902415787 1:16238164-16238186 AACCCACAGCTGGCTGGGTGTGG + Intergenic
909239263 1:73191551-73191573 TACCCACACCTTAGTGGTTCTGG + Intergenic
909745435 1:79090624-79090646 TACCCTCAGCTTGCTGGTACTGG - Intergenic
914936376 1:151984414-151984436 CACCCTCAGCTTCCTGGCTGTGG + Intronic
915106474 1:153537750-153537772 TAAAAACAGCTTGCTGGGTCAGG + Intronic
918056605 1:181026767-181026789 TTCCCGCAGCTTCCAGGGGCAGG - Intergenic
920034385 1:203056442-203056464 TAGCCGCAGCGTCCTGGGTGAGG - Exonic
922233682 1:223707323-223707345 TATCCAGAACTGCCTGGGTCTGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063249661 10:4260091-4260113 TATCCACAGTTTTCTGGGTGAGG + Intergenic
1070605287 10:77894028-77894050 CACCCACAGCTTCCTATGTGAGG - Intronic
1071775314 10:88780373-88780395 TACCCACATTTTCCAAGGTCTGG + Intergenic
1077165734 11:1137122-1137144 GACCCATAGTTGCCTGGGTCAGG + Intergenic
1078099885 11:8323738-8323760 TGCCCACAGCTTCTAGGGTGGGG + Intergenic
1078144362 11:8712923-8712945 GGCCCGCAGCTTCCTGTGTCAGG - Intronic
1080257921 11:30313122-30313144 TTCCCCCAGGTTCCTGGGTAAGG + Intergenic
1081223285 11:40489422-40489444 TACTCACAACTCTCTGGGTCAGG + Intronic
1081521102 11:43881656-43881678 AACACACAGATTCCTGGGCCTGG + Intronic
1081577772 11:44329966-44329988 TCCCTGCAGCTTCCTGGGTGTGG + Intergenic
1083225203 11:61280756-61280778 TCCCCGGAGCTTCCTTGGTCTGG - Intronic
1084978393 11:72815520-72815542 GACTCACAGCTCCCTGGGTCGGG - Intronic
1085716510 11:78878272-78878294 TAGCCACAGCTTCTTGTGCCGGG - Intronic
1087789698 11:102393212-102393234 TAGCCACAACTTCCCTGGTCGGG - Intergenic
1089257334 11:117200793-117200815 TACCCCCAGCTTCCAGTCTCAGG - Intronic
1089306398 11:117529018-117529040 TGTCCAGAGCTTCCTGTGTCAGG + Intronic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1090248954 11:125237783-125237805 AACCCACAGCTTCAAGTGTCAGG + Intronic
1092187673 12:6493245-6493267 CGCCCACAGCTGCCTGGGTAAGG - Exonic
1097056670 12:56254207-56254229 TAGCCACAGCATCCTGGCCCAGG + Exonic
1099030754 12:77523663-77523685 TCCCAAGAGCTTCCTGGGTGAGG - Intergenic
1099034212 12:77565110-77565132 TTCCCACAGCTTCCTCCTTCAGG + Intergenic
1101832893 12:108273089-108273111 TAGCCACAGTGTCCTGGGCCTGG + Intergenic
1103091782 12:118103363-118103385 TACCCCCAGCCTCCTGGGGTGGG - Intronic
1103557373 12:121774825-121774847 GGCCCACAGCATCCTGGGGCCGG + Intronic
1104444420 12:128822405-128822427 TTCCCTCAGCTTCCTGGCCCAGG + Intronic
1105323109 13:19346150-19346172 TACACACAGCTGTCTGGGTGTGG - Intergenic
1105874280 13:24539717-24539739 TACACACAGCTGTCTGGGTGTGG + Intergenic
1108144643 13:47463825-47463847 TACGCTAAGCTTCCTGGGTGGGG + Intergenic
1108283227 13:48880045-48880067 TTCTCACAGCATCCTGGGGCCGG - Intergenic
1113465208 13:110507847-110507869 GACACACAGCCTCCTGGGCCTGG + Intronic
1115376400 14:32681758-32681780 CAGCCACAGCTTCTTGGCTCAGG + Intronic
1116873319 14:50088337-50088359 TTCCCACAGCTTACTGGCTGGGG + Intronic
1118741020 14:68739265-68739287 TGCTCACAGATTCCTGAGTCAGG + Intergenic
1119476653 14:74934449-74934471 CACCCAGAGCCTCCTGGGTTTGG + Intergenic
1119716899 14:76866181-76866203 TTCCTAGAGCTTCCTGGGACAGG + Intronic
1121876211 14:97455892-97455914 GCCCCACAGCTTCATAGGTCAGG - Intergenic
1122742719 14:103881338-103881360 CAGCCTCAGCTTCCTGGGGCAGG - Intergenic
1125831823 15:42722254-42722276 GACCCTAAGCTTCCTGGGTGGGG + Intergenic
1128162654 15:65434461-65434483 TTCCCACAGCTTCTAGGGGCTGG + Intergenic
1128382349 15:67122341-67122363 CACCCACAGCTGACAGGGTCTGG - Intronic
1129453008 15:75661204-75661226 TGCCCACCGCATCCTGGCTCCGG - Exonic
1129699501 15:77759429-77759451 TGCCCACAGCTTGCTGCCTCAGG - Intronic
1130647634 15:85742820-85742842 TACTGACAGCTTCCAGGGTAGGG + Intronic
1132472851 16:116201-116223 TGCCTACAGCATCCTGGGTGGGG + Intronic
1133267855 16:4595351-4595373 AACACACAGCTTCTGGGGTCTGG - Intronic
1133412620 16:5580793-5580815 GCCCTACAGCTTCCTGGGTCTGG - Intergenic
1133414840 16:5598317-5598339 GACCCCCAGCATCCTCGGTCTGG + Intergenic
1137322806 16:47402526-47402548 TCCCCACAGCATCCCGGCTCTGG + Intronic
1137622793 16:49887359-49887381 TACCCACAGATTCCAGAGACTGG + Intergenic
1138615430 16:58161749-58161771 TGCTCACCCCTTCCTGGGTCTGG - Intronic
1140679365 16:77369073-77369095 ATCCCACAGGTTCCTGGGTGAGG - Intronic
1141646363 16:85370099-85370121 CACCCAGAACCTCCTGGGTCCGG - Intergenic
1142697321 17:1640610-1640632 GACTCACAGCTGCCTGTGTCTGG + Exonic
1144639037 17:16927518-16927540 GTCCCACAGCAGCCTGGGTCTGG - Intergenic
1144708411 17:17384852-17384874 CACCCACAGCTTCGTGGGCTGGG - Intergenic
1145123045 17:20277948-20277970 TCCCCACCCCATCCTGGGTCAGG + Intronic
1146925100 17:36739099-36739121 TACCCCCAGCTCCCTGTTTCTGG - Intergenic
1146928315 17:36760291-36760313 TACCCAGAGCCTTCCGGGTCTGG + Intergenic
1147492812 17:40886236-40886258 TACACTCAGCTTCCAGGGTTGGG + Intergenic
1150308112 17:64103946-64103968 AAACCACAGCTTCCTGGGCATGG + Intronic
1150576776 17:66437665-66437687 GACCCACAGCATCCTGACTCAGG - Intronic
1151557575 17:74854390-74854412 TTCCCTCAGCTTCCTAGGTCAGG - Intronic
1152220671 17:79063452-79063474 TACCCACCGCTTCCCTGGGCTGG - Intergenic
1154067963 18:11126976-11126998 TACCCACAGTGTCTTGGGTAGGG - Intronic
1154127208 18:11702225-11702247 TATCTACAGATTCCTGTGTCTGG - Intronic
1156366217 18:36429717-36429739 TTCACACAGCTTCATGGGTGCGG - Intronic
1156389124 18:36634279-36634301 TGCCCACTGCTTCCTGTGGCTGG - Intronic
1157110628 18:44816866-44816888 GACACACAGTATCCTGGGTCAGG - Intronic
1157426059 18:47585148-47585170 CACCCACAGCACCCTGGGTCTGG + Intergenic
1157574679 18:48735770-48735792 TACCCAAAGGTGCCTGGGTCTGG + Intronic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1160363734 18:78306666-78306688 CACTCACAGCTTCCTGGGATTGG + Intergenic
1160581067 18:79884802-79884824 TACCCACAGGTTCCTGTGCGTGG + Intronic
1161350562 19:3789073-3789095 CACCCACAGCTTCGTGGATCTGG + Intronic
1166171539 19:41030796-41030818 TATTCACAGCTTCATGGGTAAGG - Intergenic
1166295633 19:41887984-41888006 TACTCACAGATTCCTGGCCCAGG - Intronic
1167015523 19:46838599-46838621 GAGCCCCAGCTTCCAGGGTCCGG - Intronic
925115461 2:1374806-1374828 TACCCTCCGCCTCCTGGTTCAGG + Intronic
925912418 2:8582475-8582497 TCCCTGCAGCCTCCTGGGTCTGG - Intergenic
928484629 2:31717797-31717819 CACTCACTGCGTCCTGGGTCGGG - Intergenic
930427041 2:51225544-51225566 TTCTCATAGCTTCCTGGATCTGG + Intergenic
930825506 2:55693280-55693302 GAGCCCCAGCTTCCAGGGTCCGG + Intronic
934084319 2:88497349-88497371 TACCCACTGCATCCAGGGGCAGG + Intergenic
935077868 2:99763210-99763232 TAAACACAGATTCCAGGGTCAGG + Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
939449113 2:142349480-142349502 TACATTCAGCTTCCTGGCTCTGG - Intergenic
943037616 2:182766562-182766584 TACCCACAGAGGCCTGGGGCAGG + Intronic
944878270 2:203985117-203985139 AATCCAGAGCTTCCTGGGTTGGG + Intergenic
946176902 2:217927819-217927841 TGGCCACAGGTTCCTGGGGCAGG - Intronic
947351742 2:229253488-229253510 GGCCCACAGCTTCCAGGTTCTGG - Intronic
948147588 2:235719680-235719702 TGCCCAAGGCTTCCTGGGTCAGG + Intronic
948335220 2:237202118-237202140 CACCCACAGCTTCTTGGTTATGG - Intergenic
948397869 2:237661073-237661095 CTCCCACCGCTTCCTGGGTTGGG + Intronic
1169416807 20:5424160-5424182 TACTCACAGGTTCCAGGGACTGG + Intergenic
1170316058 20:15042623-15042645 TACCCACAGATTTCTGCCTCAGG + Intronic
1175190887 20:57211493-57211515 TACCCACAGCTTCCTGGGTCAGG - Intronic
1175190898 20:57211531-57211553 TACCCACAGCTTCTGGGATCAGG - Intronic
1175620977 20:60447340-60447362 TACCCACAGAGTCCTGGATCAGG - Intergenic
1175747860 20:61473406-61473428 TAGCCACAGCTTCTTAGGTGGGG - Intronic
1177072173 21:16524215-16524237 TTCCCACAGCTTCCTGCCTCTGG - Intergenic
1178891528 21:36524638-36524660 TACCTACAGCCTCCTGGACCTGG + Intronic
1179783689 21:43718425-43718447 CATCCACAGGTGCCTGGGTCTGG - Intergenic
1182097587 22:27636621-27636643 TACTGACAGCATCCTGAGTCAGG + Intergenic
1182379121 22:29872225-29872247 TCCCTACAGCTTCATGGATCTGG + Intergenic
1183210602 22:36449067-36449089 GACCTACAGCTTCTTGGGGCGGG - Intergenic
1183292364 22:37010570-37010592 TAGCCCCAGCCTCCTGGGTAGGG - Intergenic
1183364100 22:37398164-37398186 CGCCCACAGCTGCCTGGCTCTGG - Intronic
1184866225 22:47203112-47203134 TACCCACAGCCTCCAGCGTGGGG + Intergenic
949552413 3:5122298-5122320 TCCGCTCGGCTTCCTGGGTCTGG + Exonic
953768666 3:45762625-45762647 CCCCCACAGCTTACTGGGGCAGG - Intronic
954193508 3:48981709-48981731 TACCAGCTTCTTCCTGGGTCCGG - Exonic
955773020 3:62405191-62405213 TACCCCCAGCCTCCTGGGATTGG + Intronic
956035474 3:65086363-65086385 TGCCTCCAGTTTCCTGGGTCTGG + Intergenic
956581689 3:70820773-70820795 TACTCATTGCTTCCTGGATCTGG + Intergenic
959481327 3:106876194-106876216 TACTCCCAGGTTCCTGGGTTGGG - Intergenic
961325854 3:126108926-126108948 TTCACACAGCTGCCAGGGTCTGG - Intronic
963280121 3:143376139-143376161 TACTCACAGCTTACTGGGTTTGG + Intronic
965315536 3:167185263-167185285 TATACATAGCTTCTTGGGTCTGG - Intergenic
966762601 3:183430541-183430563 TAACCTCAGCTTCCTGGCTTAGG + Intergenic
970200286 4:13597904-13597926 TAGCCTCAGCTTCCTGAGACTGG + Intronic
973760345 4:54109399-54109421 TCGGCACAGCTACCTGGGTCTGG + Intronic
974589268 4:63921995-63922017 TGCCCACAGCTTGCTGAGTGGGG + Intergenic
975161920 4:71134257-71134279 TACTCCCAGATTCCTGGGCCAGG + Intergenic
978061434 4:104344878-104344900 GAGCCACAGGTTCCTGGGTGGGG + Intergenic
980911169 4:138995942-138995964 TACCCACATCTTCCCAGGTGTGG + Intergenic
983977496 4:173953173-173953195 TTCCCACAGGTCCCTGGGTGGGG + Intergenic
985511645 5:317208-317230 CACCCACGCCTTCCTGGGTGAGG + Intronic
985540171 5:484094-484116 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540193 5:484153-484175 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540215 5:484212-484234 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540237 5:484271-484293 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540259 5:484330-484352 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540281 5:484389-484411 TCTCCACACCCTCCTGGGTCCGG - Intronic
985540302 5:484448-484470 TCTCCACACCCTCCTGGGTCCGG - Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985815478 5:2125116-2125138 AACCCACAGCCTCCCGGATCTGG - Intergenic
986130206 5:4923155-4923177 GCCCCACAGCTTCCTGGATGTGG - Intergenic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
986624971 5:9715400-9715422 TACCCACAGCCTCCTGGTGCTGG - Intergenic
987428043 5:17795685-17795707 CAGCCACAGCTTGCTGGGGCAGG + Intergenic
989461824 5:41708526-41708548 TACCCATACCTTGCTGGGACAGG - Intergenic
991331601 5:65498736-65498758 TAACCTCAAATTCCTGGGTCAGG + Intergenic
992094887 5:73353755-73353777 TGGCCACAGCCTCATGGGTCAGG - Intergenic
992202016 5:74394127-74394149 TACCCACAGCTTCCTGAGCAAGG - Intergenic
997379800 5:133427455-133427477 TACCAACAGTTTCCTGGGCTTGG - Intronic
997666857 5:135636554-135636576 TACCCAGAGCTTCATGGGGAAGG - Intergenic
997789998 5:136750381-136750403 CACCCCAAGCTTCCTGGATCAGG + Intergenic
998380004 5:141717569-141717591 AACCCCCAGGTTCCTGTGTCAGG - Intergenic
998867630 5:146521196-146521218 TTCCCACAGCTTCTTTGGTGGGG - Intergenic
1000195569 5:158954301-158954323 AAGCCACAGCTTCCTTGGCCTGG - Intronic
1006387403 6:33739007-33739029 TCCCCACAGCCTCCTGGCTGGGG + Intronic
1006478668 6:34274244-34274266 TACCCACAGCTTTCAGGGTAAGG - Intergenic
1008025362 6:46629852-46629874 TGCCAACAGTTTCCTGGGCCAGG - Intronic
1011270649 6:85576429-85576451 TACCTACAGCTGACTGGTTCAGG + Intronic
1011809780 6:91117719-91117741 TACTCACAACTTCCTGAGTTGGG + Intergenic
1012761559 6:103309392-103309414 TCCCCACAGTCTCCTGGCTCTGG - Intergenic
1014014942 6:116519179-116519201 TATACACAGCTCCCTGTGTCAGG - Exonic
1015603890 6:134936454-134936476 CTCCCACAGTTTCCTGGGTAGGG + Intronic
1018460376 6:163993034-163993056 GAACCCCAGTTTCCTGGGTCTGG - Intergenic
1018460584 6:163994869-163994891 GAACCCCAGTTTCCTGGGTCTGG - Intergenic
1019148559 6:169989053-169989075 AACCCAGAGGTTCCTGGATCTGG + Intergenic
1020144281 7:5630802-5630824 TCACCACAGCTCCCTGAGTCAGG + Intronic
1023356677 7:39374435-39374457 TACTGACAGCTTTCTGGGTCTGG + Intronic
1024624445 7:51192811-51192833 TACCAACTGCTTCCTGAGTCAGG + Intronic
1024896233 7:54265448-54265470 AACCCTCAGCTTCCAGGGACTGG - Intergenic
1025810305 7:64871355-64871377 GGCCTACAGTTTCCTGGGTCTGG + Intronic
1026525423 7:71149407-71149429 TACTCACTGCCTCCTGGGTGTGG + Intronic
1026814455 7:73499484-73499506 TAGCCTCAAATTCCTGGGTCTGG - Intronic
1027797357 7:82711815-82711837 TACTCTCAGCTTCCTGGATTAGG + Intergenic
1030675864 7:112384777-112384799 TACCTTCAGCTTCCTGGCCCAGG - Intergenic
1030869012 7:114733167-114733189 TGACCACACCTTCCAGGGTCTGG - Intergenic
1031420908 7:121550540-121550562 TACCCACCGCTTTCTGGTGCTGG - Intergenic
1031646738 7:124235485-124235507 TACCCTCTGCCTCCTGGTTCAGG + Intergenic
1032415589 7:131733028-131733050 TTAGCACAGCTTCCTGGGTCAGG + Intergenic
1034442817 7:151095588-151095610 TCCCCACCCCTTCCTGGGCCTGG + Intronic
1035167214 7:156999131-156999153 AACCCTCAGCCTCCTGGGTGCGG + Intronic
1039453281 8:37692762-37692784 TCCCCACAGCAGCCTGGTTCTGG + Intergenic
1040840800 8:51782140-51782162 CACCCACAGCCTCCGGGGGCTGG + Intronic
1045034740 8:98168342-98168364 TACCCACGCCTTTCTGGGTGCGG - Intergenic
1047295428 8:123566616-123566638 AACCCACATCTTCCAGGTTCAGG - Intergenic
1048017292 8:130508843-130508865 TACCCACACACTCCTGGGGCTGG - Intergenic
1050858018 9:10386787-10386809 TACTCACAGCTTCTAGGGTGTGG - Intronic
1053268374 9:36732643-36732665 CACCCACAGCTTGCTGGTCCAGG - Intergenic
1057189975 9:93081630-93081652 TACACACACCGTGCTGGGTCTGG + Intronic
1060219447 9:121756654-121756676 TGCAGACAGCTGCCTGGGTCAGG + Intronic
1060878460 9:127100588-127100610 TACCCAAGGCTTCCTGGGTGAGG + Intronic
1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG + Intronic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1190177749 X:48165500-48165522 AACCCACAGCATCCTGGGTAGGG - Intergenic
1190180427 X:48187107-48187129 AACCCACAGCATCCTGGGTAGGG + Intronic
1190183712 X:48217158-48217180 AACCCACAGCATCCGGGGTAGGG - Intronic
1190193429 X:48296295-48296317 AACACACAGCATCCTGGGTAGGG + Intergenic
1190196857 X:48327205-48327227 AACCCACAGCATCCTGGGTAGGG - Intergenic
1190199401 X:48347286-48347308 ACCCCACAGCATCCTGGGTAGGG + Intronic
1190204553 X:48392483-48392505 AACCCACAGCATCCTGGGTAGGG - Intronic
1190205983 X:48402920-48402942 AACCCACAGCATCCTGGGTAGGG + Intronic
1190210390 X:48442114-48442136 AGCCCACAGCATCCTGGGTAGGG - Intergenic
1190297125 X:49034238-49034260 TGCCCCCAGCTGCCTGTGTCAGG - Exonic
1190654952 X:52603409-52603431 AGCCCACAGCATCCTGGGTAGGG - Intergenic
1190658390 X:52633086-52633108 AAGCCACAGCATCCTGGGTAGGG - Intergenic
1190659942 X:52644920-52644942 AACCCACAGCATCCTGGGTAGGG + Intronic
1190663594 X:52677567-52677589 AACCCACAGCATCCTGGGTAGGG - Intronic
1190666168 X:52697768-52697790 ACCCCACAGCATCCTGGGTAGGG + Intronic
1190673250 X:52760642-52760664 ACCCCACAGCATCCTGGGTAGGG - Intronic
1190675829 X:52780855-52780877 AACCCACAGCATCCTGGGTAGGG + Intronic
1190676792 X:52789424-52789446 AACCCACAGCATCCTGAGTAGGG - Intronic
1193274677 X:79571209-79571231 TACTCACCACTTCCTGGGTCAGG + Intergenic
1194641755 X:96410968-96410990 TTCCCACATGTTCCTGGTTCAGG - Intergenic
1197706954 X:129641024-129641046 TCCCTACAGGTCCCTGGGTCAGG + Intergenic
1198036610 X:132807239-132807261 TATTCACATCTTCCTGGGACAGG - Intronic
1200699685 Y:6391565-6391587 GGCCTACAGTTTCCTGGGTCTGG - Intergenic
1201034426 Y:9773133-9773155 GGCCTACAGTTTCCTGGGTCTGG + Intergenic
1202383577 Y:24300617-24300639 TATTCACAGCTTCCAGGGTTAGG + Intergenic
1202487206 Y:25369503-25369525 TATTCACAGCTTCCAGGGTTAGG - Intergenic