ID: 1175191910

View in Genome Browser
Species Human (GRCh38)
Location 20:57217053-57217075
Sequence AAGGGGAAAGGGATGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2606
Summary {0: 1, 1: 1, 2: 21, 3: 240, 4: 2343}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175191898_1175191910 -4 Left 1175191898 20:57217034-57217056 CCCCGCATGTGGAACACCCAAGG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG 0: 1
1: 1
2: 21
3: 240
4: 2343
1175191900_1175191910 -5 Left 1175191900 20:57217035-57217057 CCCGCATGTGGAACACCCAAGGG 0: 1
1: 0
2: 1
3: 14
4: 117
Right 1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG 0: 1
1: 1
2: 21
3: 240
4: 2343
1175191896_1175191910 4 Left 1175191896 20:57217026-57217048 CCGTGAGCCCCCGCATGTGGAAC 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG 0: 1
1: 1
2: 21
3: 240
4: 2343
1175191897_1175191910 -3 Left 1175191897 20:57217033-57217055 CCCCCGCATGTGGAACACCCAAG 0: 1
1: 0
2: 0
3: 2
4: 137
Right 1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG 0: 1
1: 1
2: 21
3: 240
4: 2343
1175191894_1175191910 13 Left 1175191894 20:57217017-57217039 CCTACTGCACCGTGAGCCCCCGC 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG 0: 1
1: 1
2: 21
3: 240
4: 2343
1175191902_1175191910 -6 Left 1175191902 20:57217036-57217058 CCGCATGTGGAACACCCAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 119
Right 1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG 0: 1
1: 1
2: 21
3: 240
4: 2343
1175191893_1175191910 29 Left 1175191893 20:57217001-57217023 CCTCAGAGATGCTTTTCCTACTG 0: 1
1: 0
2: 2
3: 37
4: 274
Right 1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG 0: 1
1: 1
2: 21
3: 240
4: 2343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175191910 Original CRISPR AAGGGGAAAGGGATGGAGGC AGG Intronic
Too many off-targets to display for this crispr