ID: 1175192485

View in Genome Browser
Species Human (GRCh38)
Location 20:57220892-57220914
Sequence CAGGGCAAAGATACTGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 279
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 256}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175192485 Original CRISPR CAGGGCAAAGATACTGTGGC CGG Intronic
901102045 1:6726446-6726468 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
904995016 1:34624955-34624977 CAAGGGAAAGATCCTGAGGCTGG + Intergenic
905000879 1:34668251-34668273 AAGTGCAAAGGTCCTGTGGCAGG + Intergenic
905078438 1:35295327-35295349 AAGGGCAAAGATTATGAGGCAGG + Intronic
905913975 1:41672403-41672425 CAGGGCAGAGAAGCTGAGGCCGG - Intronic
906778916 1:48555059-48555081 TAGGGCAATGACACTATGGCAGG + Intronic
907661021 1:56392515-56392537 CAGGGGAAAGTTACTATAGCTGG - Intergenic
909325121 1:74341809-74341831 CAGGGCATTGAATCTGTGGCTGG + Intronic
910458772 1:87426027-87426049 CAGGGGAAAGATAATTTGGGGGG + Intergenic
912522355 1:110254312-110254334 CAGGGGTCAGATCCTGTGGCTGG - Intronic
913411924 1:118561665-118561687 CAAGTCAAAGATTCTGTGGTAGG + Intergenic
914316054 1:146512915-146512937 CAGGGGAAAGATAATTTGGTGGG + Intergenic
914498301 1:148220446-148220468 CAGGGGAAAGATAATTTGGTGGG - Intergenic
915025317 1:152824104-152824126 GAGGGAAAAGTTACTGTGGATGG - Intergenic
918170503 1:181992163-181992185 CAGGTAAAAGCTACTGTGCCTGG - Intergenic
919905707 1:202076911-202076933 CAGCGCAAAGGTCCTGGGGCAGG + Intergenic
923396586 1:233571763-233571785 CAGAGCAAGGATACTGGTGCAGG - Intergenic
1062992377 10:1832593-1832615 CAGTGCAAAGACCCTGGGGCAGG + Intergenic
1063421251 10:5914341-5914363 CAGAGCAAAGATGCCCTGGCAGG - Intronic
1064444371 10:15380407-15380429 CAGGTGCAAGATACTGTGTCTGG - Intergenic
1064951882 10:20861473-20861495 GAGGGCAATAAGACTGTGGCTGG - Intronic
1066654801 10:37687506-37687528 CAGAGCAAAGGCCCTGTGGCAGG + Intergenic
1067039752 10:42942976-42942998 CAGAGCAAAGGCCCTGTGGCAGG + Intergenic
1067090340 10:43263137-43263159 GAGGGAACAGATGCTGTGGCTGG + Intronic
1068422466 10:56812980-56813002 AAGGTCAAAGATATTATGGCAGG - Intergenic
1069679968 10:70277451-70277473 CAGGGCACAGAGACTCTGGCAGG + Intronic
1069787541 10:70998302-70998324 CAGGACAGGGATGCTGTGGCAGG + Intergenic
1070776789 10:79114434-79114456 CCAGGCCAAGATGCTGTGGCTGG - Intronic
1073638115 10:105220210-105220232 TAGGGCAAAGATTCTGAGCCAGG - Intronic
1074448389 10:113539119-113539141 CAGGGCAAAGATGCTGACACTGG + Intergenic
1074941668 10:118241865-118241887 CAGGGGAAAGATTCTGTGGCAGG + Intergenic
1076184410 10:128435118-128435140 CAGGACAAAGCCACTGGGGCTGG - Intergenic
1076557298 10:131335543-131335565 CACAGCAAAGCTACTGTGGTGGG - Intergenic
1078050270 11:7959714-7959736 GAGGGCAAAGATAATATAGCAGG - Exonic
1078473305 11:11609351-11609373 CAGTGCAAAGCCCCTGTGGCAGG - Intronic
1079405847 11:20145065-20145087 CAGGGCATACATGCAGTGGCAGG + Intergenic
1080169323 11:29280513-29280535 CAGGGAAAAGGGACTGAGGCTGG + Intergenic
1081719515 11:45277640-45277662 CTGTGCAAAGGTCCTGTGGCAGG - Intronic
1084490039 11:69473236-69473258 GAGGGCAGAGACACTGTGGCAGG + Intergenic
1085678203 11:78545426-78545448 AAGTACAAAGATTCTGTGGCTGG - Intronic
1085812566 11:79697996-79698018 CAGTGCAAAGATTTTGTGGCTGG + Intergenic
1086406937 11:86506648-86506670 CATGTCACAGATACTGTGCCAGG - Intronic
1086408296 11:86518466-86518488 CAGGACAAAGAAAATCTGGCTGG - Intronic
1088529645 11:110794431-110794453 CAGGCCTAAGTTACTGTGCCCGG + Intergenic
1089419880 11:118323691-118323713 CTAGGCAAAGATACTTTGGTTGG + Intergenic
1089451927 11:118604858-118604880 CAGGGCAAAAAAACTGCGGTGGG - Intergenic
1089949269 11:122510190-122510212 CAAGGCAGAGACACAGTGGCTGG - Intergenic
1089982230 11:122781673-122781695 CAGGGCAAAGACATGGTGGCCGG - Intronic
1090844105 11:130516643-130516665 CAGAGCACAGATATTTTGGCAGG + Intergenic
1091348691 11:134874967-134874989 GAGGGCAAAGCCACTGTGGGTGG - Intergenic
1091858538 12:3758293-3758315 CACGGTCAAGATACTGTGGTTGG - Intronic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1093624933 12:21334312-21334334 CCAGGCACACATACTGTGGCAGG - Intronic
1094052354 12:26234975-26234997 CAAGGCAAAGAGAGTCTGGCTGG + Intronic
1094213984 12:27921373-27921395 CAGAGCAAAGATGCTGAGGTGGG - Intergenic
1096465324 12:51845465-51845487 CAGGGGACAGAGACTGTGGGGGG - Intergenic
1098095524 12:66951380-66951402 CAGCACAAAGGTTCTGTGGCAGG + Intergenic
1099351863 12:81581316-81581338 CAAGGCAGAGAAAATGTGGCTGG - Intronic
1100022058 12:90081115-90081137 CAGGGCAAATCGACTGTGACTGG + Intergenic
1100722513 12:97373860-97373882 CCGGGCAAAGAGACTGAGGAGGG + Intergenic
1101063179 12:100992912-100992934 CAGGGGTGAGACACTGTGGCTGG - Intronic
1101725655 12:107386104-107386126 CAGGGCAAAGGCCCTGAGGCAGG - Intronic
1101920140 12:108925739-108925761 CAGTGCAAAGATCCTGAGGCAGG - Intronic
1102117929 12:110417577-110417599 CAGGACAAAGAAAATCTGGCTGG - Intergenic
1102396365 12:112589460-112589482 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1103943745 12:124514848-124514870 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1106517331 13:30466102-30466124 CCGGGCAAAGAGGCTGAGGCGGG + Intronic
1106773387 13:32984585-32984607 ATGTGCAAAGATCCTGTGGCAGG - Intergenic
1107452429 13:40521988-40522010 AAGGGCAAAAACACTGAGGCAGG - Intergenic
1108187013 13:47898068-47898090 ATGGGCAAACAAACTGTGGCAGG + Intergenic
1110693064 13:78454767-78454789 CTGGGAATAGATAGTGTGGCAGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113673922 13:112195566-112195588 CAGGGCAGAGAGACTGTGAAAGG - Intergenic
1115772972 14:36685936-36685958 CAGGGAAAAGATAGGGTGGGGGG - Intronic
1115817346 14:37177531-37177553 CAGGTAAAACATACTATGGCTGG - Intergenic
1116056478 14:39870609-39870631 CAGGGCAAGGACAGAGTGGCAGG + Intergenic
1116859115 14:49979465-49979487 CAAGTCTAAGACACTGTGGCAGG - Intergenic
1119900197 14:78253101-78253123 CAGAGCAAACATACTGTGGGAGG - Intronic
1121598086 14:95181121-95181143 CAGTGCAAAGGCACTGAGGCAGG - Intergenic
1124893411 15:33754442-33754464 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1125212466 15:37233235-37233257 CAGGTCAAAGACAGTGAGGCAGG + Intergenic
1125282006 15:38052133-38052155 CAGTGCAAAAGTCCTGTGGCAGG - Intergenic
1125610798 15:40968608-40968630 CAGGGAAAAGCCACTGTGCCTGG + Intergenic
1130727246 15:86452064-86452086 CCGGGCAAAGCTACTGTGGCTGG - Intronic
1131111200 15:89766326-89766348 GAAGGCAAAGATCCTGAGGCAGG - Intronic
1131255313 15:90858245-90858267 CAGTGCAAAGGCCCTGTGGCAGG + Intergenic
1133231242 16:4367695-4367717 CTGTGCAAAGGTCCTGTGGCAGG + Intronic
1134210514 16:12272484-12272506 CAGGACACAGATACCTTGGCAGG - Intronic
1134684386 16:16148494-16148516 CAGGCGTGAGATACTGTGGCTGG - Intergenic
1134770884 16:16808518-16808540 CAGGCATAAGATACTGTGCCTGG - Intergenic
1135671501 16:24379561-24379583 AAGGATAAAGATACTGAGGCTGG - Intergenic
1136077337 16:27826213-27826235 CTGGGGAAAGACACAGTGGCAGG + Intronic
1139543775 16:67638700-67638722 CAGGGCAAAGAAAATGTCGATGG - Exonic
1139684467 16:68592079-68592101 AAGTGCAAAGTTCCTGTGGCAGG - Intergenic
1140395144 16:74620033-74620055 CAGAACAAAGAAACTGAGGCAGG + Intergenic
1142685033 17:1572658-1572680 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142687825 17:1587884-1587906 CAGGGTACAGAGGCTGTGGCTGG - Intronic
1142817146 17:2435547-2435569 CAGTGCTAAGAAACTGTTGCTGG + Intronic
1144090174 17:11849307-11849329 CAGTGCAGACACACTGTGGCAGG - Intronic
1144327596 17:14196787-14196809 GAGGGCAAAGAGAGTGTGGGAGG - Intronic
1144761028 17:17707492-17707514 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1144773060 17:17770276-17770298 CAGGGGAAGGAGCCTGTGGCTGG + Intronic
1147265529 17:39232153-39232175 CTGGGGAGAGATCCTGTGGCGGG + Intergenic
1147575499 17:41596558-41596580 CAGGGCCCACATTCTGTGGCTGG + Intergenic
1147975656 17:44246889-44246911 CAGGGCAAAGAGAGAGTGGCTGG - Intergenic
1149040455 17:52182186-52182208 CAAGGGAAAGACACTGTGCCGGG + Intergenic
1152315635 17:79578835-79578857 CTGGGCAAAGACCCTGTGCCAGG - Intergenic
1155757042 18:29512661-29512683 CGGTGCAAAGGTACTGAGGCAGG + Intergenic
1157128088 18:44976582-44976604 CAGGGCAAAGATACTGCTCAGGG + Intronic
1160728564 19:629977-629999 CTGGGCAAAGATACTGGAGAAGG - Exonic
1161517480 19:4704364-4704386 CAGGGCAGAGATCCTCGGGCTGG + Intronic
1161536360 19:4821477-4821499 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1161629367 19:5344554-5344576 CAGTGCAAAGGCTCTGTGGCAGG - Intergenic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1161772259 19:6237181-6237203 CAAGGCAAAGGCCCTGTGGCCGG + Intronic
1162199423 19:9009925-9009947 CTGGGCACAGATACTGGGACTGG + Intergenic
1162839584 19:13346311-13346333 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
1165125186 19:33590114-33590136 CAGGACAAAGAAAATTTGGCAGG + Intergenic
1165200722 19:34142274-34142296 CAGGACAGAGATACTGTTGCAGG + Intergenic
1165958737 19:39517633-39517655 CAGTGCAAAGGTCCTGAGGCAGG + Intronic
1166827002 19:45616046-45616068 CAGGGCCAGAATACTGTGGGCGG + Intronic
1167150612 19:47707249-47707271 CAGTGCAAAGGCCCTGTGGCAGG + Intergenic
1168607706 19:57772908-57772930 CAGGGAAAAGAGACTATGTCAGG - Intronic
925637281 2:5952299-5952321 AAGTGCAAAGGTCCTGTGGCAGG - Intergenic
926107652 2:10162511-10162533 CAGGCCAAGGAGAGTGTGGCCGG - Intronic
927817310 2:26230216-26230238 CAGGGCAAAGAAAATGGGACTGG - Exonic
929033689 2:37671765-37671787 CAGGGCACAGGTACCGCGGCTGG - Exonic
929059123 2:37905252-37905274 CAGGGCAAAGGTGCTGTGGTGGG - Intergenic
929392101 2:41481622-41481644 CAGGGGAAAGAGAATGAGGCAGG + Intergenic
929655129 2:43723429-43723451 CAAGGCAAAGAGACTTGGGCTGG + Intronic
931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG + Intergenic
932641232 2:73449290-73449312 CAGGGAAAAGAAAGTCTGGCAGG - Exonic
935688335 2:105706889-105706911 CTGGGCAAAGGCACTGGGGCAGG - Intergenic
936376975 2:111949033-111949055 CAGTGCAAAGGTCCTGAGGCAGG - Intronic
937428347 2:121817948-121817970 CAGGGCAAAGATGGTGTTGGGGG + Intergenic
938517896 2:132035985-132036007 CAGGCCTAAGACACTGTGCCCGG + Intergenic
940192785 2:151060297-151060319 CAGAGAACAGATGCTGTGGCAGG - Intergenic
942589513 2:177527019-177527041 GAGGACAAGGATACTGAGGCAGG - Intronic
944659559 2:201910077-201910099 CAGCCCAAAGACACTGTAGCTGG + Intergenic
944873543 2:203938357-203938379 AAGTGCAAAGAGCCTGTGGCAGG + Intronic
946406200 2:219493233-219493255 CAGGACACAGATACAGTGGCAGG + Exonic
946788773 2:223277007-223277029 TGGGGCAAAGACACTGAGGCAGG + Intergenic
947537084 2:230946838-230946860 CAGGGCAAGGCAGCTGTGGCTGG + Intronic
948023662 2:234758302-234758324 CAGTGCAAAGGTACTGAGGCAGG - Intergenic
948523525 2:238557076-238557098 CAGCCCCAAGATACTGTGGAGGG + Intergenic
948718843 2:239883468-239883490 CAGGGAACAGACACAGTGGCAGG - Intergenic
948912361 2:241010997-241011019 CAGGGTAGAGATGCTGCGGCAGG - Intronic
1172027769 20:31960711-31960733 AAGTGCAAAGGCACTGTGGCAGG + Intergenic
1172204846 20:33155954-33155976 CAGGGCACAAATTCTGTGTCAGG - Intergenic
1172880606 20:38197402-38197424 AAGTGCAAAGATCCTGGGGCAGG + Intergenic
1173551128 20:43933877-43933899 TCAGGCAAAGATACTGTGACTGG - Intronic
1174121482 20:48268924-48268946 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
1174586031 20:51609075-51609097 CAGTGCAAAGGCACTGAGGCGGG + Intronic
1175102765 20:56591542-56591564 CAGGGCAAAGCCACTGTGCCCGG + Intergenic
1175192485 20:57220892-57220914 CAGGGCAAAGATACTGTGGCCGG + Intronic
1176869962 21:14076303-14076325 CAGGGCAGAGGGACTGGGGCCGG + Intergenic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1178818652 21:35954924-35954946 CAATGCAAAGATTCTGTGGTGGG - Intronic
1180929410 22:19578840-19578862 CAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1181836665 22:25615936-25615958 CAGGGCAAAGACCCTAAGGCTGG + Intronic
1182028228 22:27137039-27137061 CAGGGCCAAGATTCTGTGAGTGG - Intergenic
1182790463 22:32948291-32948313 TAGGGCATAGACACTGTAGCGGG + Intronic
1183022005 22:35034868-35034890 CAGTGCAAAGATCCGGAGGCAGG + Intergenic
1184377709 22:44124920-44124942 CAGGGCCAAGTTTCTCTGGCAGG - Intronic
1184838028 22:47035588-47035610 CAGGGCAAACGTGCTGGGGCGGG - Intronic
1184975508 22:48058728-48058750 CAGGGTAAAGATAAGGTTGCGGG + Intergenic
1185153486 22:49179683-49179705 CAGGGCAGAGATACACTGCCTGG + Intergenic
949219687 3:1616990-1617012 CTGGGCAAAGATTCAGTGCCTGG + Intergenic
950614992 3:14151047-14151069 CAAGCAAAAGATACTGAGGCAGG + Intronic
950999992 3:17547003-17547025 AAAGGCAAAGGTAGTGTGGCTGG - Intronic
951678441 3:25268640-25268662 CAGTGCAAAGGTGCTGAGGCAGG - Intronic
951752968 3:26057518-26057540 CAGGGCAGAGATACAGAGGCAGG - Intergenic
952446986 3:33390699-33390721 CAGGTGAAATATACTGTGTCAGG + Intronic
954638888 3:52086262-52086284 CAGGGCAAACGTCCTGGGGCTGG + Intronic
954680278 3:52342190-52342212 CAGGGCAGGGTTACTGTGGTTGG + Intronic
954691391 3:52397423-52397445 CAGTGCAAAGGGCCTGTGGCAGG + Intronic
955454917 3:59109616-59109638 AAGTGCAAAGATTCTGTGGTGGG + Intergenic
958850303 3:99317038-99317060 CAAGGCAAAGATGGTGTGGGTGG + Intergenic
960891929 3:122458203-122458225 CAGCACAAAGATACTGGGCCTGG + Intronic
961149703 3:124627538-124627560 CAAGGCACAGTTAATGTGGCCGG + Intronic
961396205 3:126592870-126592892 CAGGCCAAAGCCACTGTGCCTGG + Intronic
961565118 3:127758106-127758128 CAGTGCAAAGGTCCTGGGGCAGG - Intronic
965012243 3:163108420-163108442 CAGGCAAGAGATAGTGTGGCAGG + Intergenic
965141720 3:164845913-164845935 TAGGGCAAAGACATTGTGGTTGG + Intergenic
967070190 3:185956397-185956419 GAGGGCAAAGTTGCAGTGGCTGG - Intergenic
968627536 4:1633960-1633982 CAGGGCAATGAGGCTGTGGCTGG + Intronic
970290259 4:14563930-14563952 CAGGGGAAAGAAGCTGTGTCAGG + Intergenic
971552122 4:27970531-27970553 CAGAGCAAAGATTCTGAAGCAGG - Intergenic
975736531 4:77386537-77386559 AAGGGCCAAGATACTAAGGCAGG - Intronic
977185632 4:93932529-93932551 CACCGCAAAGACACTGTAGCTGG - Intergenic
980111238 4:128639382-128639404 CAGTGCAAAAATAATGTGGCAGG - Intergenic
983256450 4:165405716-165405738 CAGGGCAAAGAAAATGGGACTGG - Intronic
987261624 5:16210176-16210198 AAGGCCAAAGTCACTGTGGCAGG + Intergenic
990515948 5:56530956-56530978 CAGGGCAAAGCTGCTGAGACAGG - Intronic
990971295 5:61509393-61509415 TTTGGCAAAGATACTGTGGGAGG + Intronic
991192048 5:63885909-63885931 CAGGACAAAGCTCTTGTGGCTGG - Intergenic
991505655 5:67321387-67321409 CAGGGCAGAGATCTTGTGGGAGG + Intergenic
994217003 5:97149096-97149118 GAGGTCAAAGATACTGAGGGAGG + Intronic
994871048 5:105350927-105350949 AAGAGCACAGAAACTGTGGCTGG - Intergenic
996339718 5:122423082-122423104 CAGGGCCAAGCTCCTGAGGCTGG - Exonic
996377941 5:122834890-122834912 CAGGGTCAAGATCTTGTGGCTGG + Intergenic
997566323 5:134889499-134889521 CAGATGTAAGATACTGTGGCTGG + Intronic
998141542 5:139702328-139702350 AAGTGCAAAGATCCTGAGGCAGG - Intergenic
998396066 5:141818880-141818902 CTGTGCAAAGATCCTGTGGCAGG + Intergenic
999111428 5:149124912-149124934 CAGTGCAAAGACACAGAGGCGGG + Intergenic
999491805 5:152058482-152058504 CAGGCTGAAGATACTGTAGCTGG + Intergenic
1000183109 5:158831870-158831892 AAGTGCAAAGATCCTGAGGCAGG + Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1002803614 6:550895-550917 CAGGGCAGAGAAGATGTGGCAGG - Intronic
1003455527 6:6278433-6278455 CAGTGCAAAGACCCTGTGGGAGG + Intronic
1003467229 6:6392401-6392423 CAGCCCAAAGATACAGTGACAGG - Intergenic
1004205354 6:13587170-13587192 CAGGCCTAAGATACTGAAGCCGG - Intronic
1005922230 6:30412388-30412410 AAGGGCAGAGATTCTGTGACTGG - Intergenic
1006407032 6:33851455-33851477 CAGGACAAAGACCTTGTGGCCGG - Intergenic
1006643702 6:35501995-35502017 CAGTGCAAAGGTCCTGTGGCAGG - Intronic
1007658044 6:43464539-43464561 TAGTGCAAAGATCCTGAGGCAGG - Intergenic
1007705543 6:43788553-43788575 CAGTGCAAAGGCCCTGTGGCAGG - Intergenic
1008127264 6:47682589-47682611 CAGGGAGAAGATAATGTGGAAGG - Exonic
1009423226 6:63486540-63486562 CAGGGCAAAGATGCAGAGGTAGG + Intergenic
1014214504 6:118739309-118739331 CAGGGCAGAGAGACAGTGGAGGG + Intergenic
1016763755 6:147769172-147769194 CAAAGCAAAGAGACTGTGCCTGG + Intergenic
1016993566 6:149945598-149945620 CAGGGAACAGATACAGTGGTAGG + Intronic
1019113964 6:169741669-169741691 AAGTGCAAAGATCCTGAGGCAGG - Intronic
1020376763 7:7495998-7496020 CTGTGCAAAGATCCTGTGGCAGG - Intronic
1021668244 7:23009918-23009940 AAGGGCAAAAAGACTCTGGCAGG + Intronic
1022415543 7:30173739-30173761 CAGGGCACAGTCACAGTGGCTGG + Intergenic
1028719222 7:94010632-94010654 CAGGGTAAATATTCTGTGGGTGG - Intergenic
1029662636 7:101973104-101973126 CTGGGCAAGGATACCGTGGATGG - Intronic
1032486845 7:132294251-132294273 CAGGACAAAGATCCTGAAGCAGG + Intronic
1032695131 7:134329240-134329262 CAGGGCAGAGACGCTGGGGCAGG - Intergenic
1033561645 7:142537632-142537654 CAGGACAAATATTCTCTGGCTGG - Intergenic
1033668259 7:143464423-143464445 CAGGGCAGAGATACTGGATCAGG - Intergenic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034492549 7:151401591-151401613 CTGGGGAGAGATACTGTGGTAGG + Intronic
1035332695 7:158106667-158106689 CAGGGCACAGATAGTGTGACAGG - Intronic
1036830894 8:12018892-12018914 CAGGGCAAAGATGCTTTGAAAGG - Intergenic
1036901030 8:12669330-12669352 CAGGGCAAAGATGCTTTGAAAGG - Intergenic
1038011087 8:23476328-23476350 AAGGTCAAAGACACTGTGGGTGG - Intergenic
1038505852 8:28084430-28084452 CAGAGAAAAGATGCTGTGGAAGG - Intergenic
1039703573 8:39985251-39985273 CAGGCCAAATATTCTGGGGCTGG + Intronic
1040033856 8:42850110-42850132 CAGGGCAGAGCTCCTGAGGCTGG + Intronic
1042935642 8:74055224-74055246 AAGGGCACAGATACTATGGCTGG + Intergenic
1045893021 8:107180741-107180763 CAGGGGAAAGCCACTGTGCCTGG - Intergenic
1047438357 8:124854661-124854683 CATGTCCAAGATACTGTGGTAGG + Intergenic
1047624515 8:126642489-126642511 TATGGCAAGGACACTGTGGCGGG - Intergenic
1048432744 8:134385357-134385379 CAGGGCTAAGATTCTGTGTTAGG + Intergenic
1049034996 8:140068422-140068444 CAGGGCAAAGACGCTTGGGCAGG + Intronic
1049591744 8:143465893-143465915 CAGGGCCCAGAGACGGTGGCTGG + Intronic
1050752071 9:8950895-8950917 CACGGCAAATATACTGTGCAAGG + Intronic
1052221797 9:26032944-26032966 CAGGGCAAAGAAATAGAGGCAGG - Intergenic
1053542938 9:38993622-38993644 CATGGCACACACACTGTGGCAGG + Intergenic
1053807381 9:41817139-41817161 CATGGCACACACACTGTGGCAGG + Intergenic
1054623211 9:67370288-67370310 CATGGCACACACACTGTGGCAGG - Intergenic
1055564762 9:77557121-77557143 CAGGGCAAGGCTGCTGTGGAGGG - Intronic
1055565787 9:77567568-77567590 CAGGGTAAAGATATTCCGGCTGG + Intronic
1056532975 9:87503405-87503427 TAGGGCAGAGACACTGTGCCTGG + Intronic
1057296559 9:93848017-93848039 CAGGGCTCAGAGACTGTGCCAGG - Intergenic
1057428813 9:94976192-94976214 CTGGGCAAAGGTTCTGTGGAAGG - Intronic
1057468183 9:95335196-95335218 GATGGCAAAGATACAGAGGCAGG - Intergenic
1057725272 9:97563959-97563981 CAACACAAAGATACTGTGGAAGG - Intronic
1059180930 9:112211404-112211426 CAGGGGAAAGAATCTGGGGCTGG + Intergenic
1061893589 9:133635454-133635476 GATGGCAAAGGTCCTGTGGCAGG + Intergenic
1062656785 9:137607725-137607747 CAGGTCACAGCTTCTGTGGCAGG + Intronic
1186123734 X:6390083-6390105 CAGGGTAGACGTACTGTGGCAGG - Intergenic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1187038086 X:15563763-15563785 GAGGGAAATGACACTGTGGCTGG + Intronic
1187869877 X:23755705-23755727 CAGGCATAAGATACTGTGCCTGG - Intronic
1188841522 X:35023664-35023686 CAGGGCAGTGATACATTGGCAGG + Intergenic
1190336805 X:49267519-49267541 CAGGGCAAAGGTCCTGAGGTGGG + Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1192932597 X:75824075-75824097 GATGGCAAAGAAACTATGGCAGG + Intergenic
1193329768 X:80223114-80223136 CAGGGCAGGGATATAGTGGCAGG + Intergenic
1198384096 X:136111805-136111827 CTGGACAAGGATAGTGTGGCTGG - Intergenic
1198747472 X:139904843-139904865 AAGGCCAGAGATACTGTTGCAGG + Intronic
1199716311 X:150509385-150509407 CAAGCCAAGGATGCTGTGGCTGG - Intronic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1200613210 Y:5348569-5348591 AAGGGCAAAGACACAGAGGCAGG - Intronic