ID: 1175193450

View in Genome Browser
Species Human (GRCh38)
Location 20:57226381-57226403
Sequence GGGTCAGAGGGCCCACACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175193450 Original CRISPR GGGTCAGAGGGCCCACACAT GGG (reversed) Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
904425055 1:30417637-30417659 AGGTCAGAGGGGACAGACATGGG - Intergenic
908977893 1:69920252-69920274 TGCTCAGAGGGCCCACAGCTGGG - Intronic
909066290 1:70939453-70939475 GGGTCAGAGCCCCCACACAGGGG - Intronic
913094861 1:115506859-115506881 GGGTCAGAGGGCCGACAGGCTGG + Intergenic
918591384 1:186245174-186245196 GGGTCAGAACCCCCACACAGAGG - Intergenic
919129220 1:193432828-193432850 GGGTGGGAGCCCCCACACATGGG - Intergenic
919724299 1:200872331-200872353 GGGTCAGAGAAGCCACTCATAGG + Intergenic
921935664 1:220794142-220794164 GGGTGGGAGGGCACACACAGTGG - Intronic
922801202 1:228365501-228365523 TGGTCAGAGAGACCACACAGAGG + Exonic
923295800 1:232593994-232594016 GGGTCAGAGGTCCCACCGCTTGG - Intergenic
1064032495 10:11891794-11891816 GGGTCACAGGGACTACATATTGG - Intergenic
1065226095 10:23545287-23545309 GGGTCAGAGCCCCCACACAGAGG + Intergenic
1066995337 10:42557627-42557649 GGGTCGGACGGCCCACAAGTTGG + Intergenic
1068436325 10:56995660-56995682 AGGTCACAGGTCCCACACTTTGG + Intergenic
1069883294 10:71607559-71607581 GGGTGAGAGGGGCCACAGCTGGG + Intronic
1070560736 10:77564807-77564829 GGGTCAGAGGGCGGACTCTTTGG + Intronic
1070752092 10:78969959-78969981 AGGTCAGAGCGCGCACACACAGG + Intergenic
1073658601 10:105446781-105446803 GGTTCAGAGGGCACACATACAGG + Intergenic
1075743901 10:124713003-124713025 GGGTGGGAGGGCACACACACAGG + Intronic
1076381542 10:130027400-130027422 GGGATAGCGGTCCCACACATGGG - Intergenic
1078804078 11:14679333-14679355 GTGGGAGTGGGCCCACACATAGG - Intronic
1079371328 11:19855495-19855517 GGGTGAGAGGGCTCCCACATTGG + Intronic
1084188499 11:67488161-67488183 GGGTTGGAGGACCCAAACATGGG - Intronic
1085941808 11:81213982-81214004 GGGTCAGAGCCCCCACACAGGGG - Intergenic
1091178377 11:133581411-133581433 AGGTCAGAGGGCCAACCCAGAGG + Intergenic
1094274657 12:28658537-28658559 CTGTCAGAGGGTCCACAAATAGG - Intergenic
1094602299 12:31920052-31920074 GGGTGAGATGGCCCACACTTTGG + Intergenic
1099201116 12:79678465-79678487 GGGTGCCAGTGCCCACACATTGG - Intronic
1103440112 12:120956777-120956799 GGAGCAGAGGGCACACACAGTGG - Intergenic
1103465599 12:121139703-121139725 GGGTCAGAGGGGCCATGCTTGGG - Intronic
1105278930 13:18952011-18952033 GGGCTGGATGGCCCACACATGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106718803 13:32418503-32418525 GGGTCAAAGCCCCCACACAGAGG + Intronic
1113162140 13:107393571-107393593 GGCTCAGTGGGCCCGCCCATAGG + Intronic
1113388184 13:109870406-109870428 GGGTCAGAGGGTGCAGACCTGGG - Intergenic
1113614753 13:111672145-111672167 GGGTAATAGGGCCCACTCTTGGG - Intronic
1113620222 13:111757059-111757081 GGGTAATAGGGCCCACTCTTGGG - Intergenic
1115217486 14:31026884-31026906 GGGAAAGAGGGCCCACCCTTGGG - Intronic
1120747301 14:88164025-88164047 GGGGCAGAGGTCACACACAGAGG - Intergenic
1123155313 14:106219114-106219136 GGGTCAGAGGGCCAACGTACTGG - Intergenic
1123206742 14:106720806-106720828 GGGTCAGAGGGCCAACGTACTGG - Intergenic
1123211764 14:106767811-106767833 GGGTCAGAGGGCCAACGTACTGG - Intergenic
1123401977 15:19996241-19996263 GGGTCAGAGGGCCAACGTACTGG - Intergenic
1123511318 15:21002905-21002927 GGGTCAGAGGGCCAACGTACTGG - Intergenic
1123578150 15:21693676-21693698 GGGTCAGAGGGCCAACGTACTGG - Intergenic
1123614775 15:22136158-22136180 GGGTCAGAGGGCCAACGTACTGG - Intergenic
1124226278 15:27897673-27897695 GGGTCAGAGGTGCCACACTGAGG + Intronic
1124503922 15:30255482-30255504 GGGGAAGAGGGCCCAGACATAGG + Intergenic
1124739632 15:32283158-32283180 GGGGAAGAGGGCCCAGACATAGG - Intergenic
1126686458 15:51252597-51252619 CAGTCTGAGGGCCCACAGATGGG - Intronic
1127357375 15:58213340-58213362 GGGTCAAAGGCCCCAGACCTGGG - Intronic
1128739208 15:70072136-70072158 GGGTCACAGGCCCCACTCGTTGG + Intronic
1131303871 15:91224129-91224151 GGGGCAGAGGGCCCAGGGATGGG + Intronic
1202987020 15_KI270727v1_random:427921-427943 GGGTCAGAGGGCCAACGTACTGG - Intergenic
1133288131 16:4700562-4700584 TGGTCAGAGGGACCACAGAAAGG + Intronic
1135770794 16:25217021-25217043 GGATCAGATGGCACAAACATCGG - Exonic
1139596519 16:67961538-67961560 GCGGCAGAGGGGCCACACCTGGG - Intronic
1141935139 16:87233578-87233600 GCATCAGAGAGACCACACATGGG + Intronic
1143014077 17:3882566-3882588 TGGTCAGAGGGAGCAGACATGGG + Intronic
1147340649 17:39751633-39751655 GGGTGACAGGGCCCACATCTGGG + Intergenic
1147440959 17:40447023-40447045 GGGCCAGTGGGCCCAAACCTTGG - Intronic
1148777268 17:50102596-50102618 GGGAGAGAGGGCCCGCACACAGG - Intronic
1150284209 17:63946305-63946327 GGGTCAGAGGGCCCAGCATTCGG + Intronic
1151835893 17:76582602-76582624 GGATCAGTGGGTCCCCACATGGG - Intronic
1152325290 17:79632471-79632493 TGGTCAGAGACCCCAGACATGGG - Intergenic
1157308918 18:46537385-46537407 GGGTCAGAGGGCACTGTCATAGG - Intronic
1158287709 18:55903122-55903144 GGGTCAGAGGCCCAAGACCTTGG + Intergenic
1158781486 18:60657275-60657297 TGGTCACAGGTCACACACATAGG + Intergenic
1159133632 18:64309992-64310014 GGCTCAGAGGTGCAACACATTGG + Intergenic
1163021431 19:14482840-14482862 GGGTCGGGGGGCCCCCAAATGGG - Exonic
1164827928 19:31297995-31298017 GGGTCAGTGGGCCACCACCTCGG + Intronic
1166533247 19:43554880-43554902 AGGGCACAGGGCCCACACAGGGG + Intronic
925922140 2:8645297-8645319 GGGTCAGAGGGCACAGCGATGGG - Intergenic
927840216 2:26436849-26436871 GGGTCTCAGGGCCCCCACATGGG + Intronic
929042063 2:37754122-37754144 GGGTCAGAGTGTCTACACAGAGG - Intergenic
930424841 2:51199758-51199780 GGGTCAGAGGAGCCATACAATGG - Intergenic
930885121 2:56316390-56316412 GGGTCTGAGGACCCACACAAAGG + Intronic
932108309 2:68969486-68969508 GTCGCAGAGGGCCCACACTTGGG - Intergenic
932336369 2:70933521-70933543 GAGTCAGAGGGACCTCAGATGGG + Intergenic
932640065 2:73436864-73436886 CTTTCAGAGGGCACACACATTGG - Intronic
936241805 2:110794263-110794285 GGGCCAGAGAGCACACACAGAGG - Intronic
937982340 2:127623058-127623080 GCTTCAGAGGGCCCACCCCTGGG + Intronic
938760805 2:134424233-134424255 GGGTAAGATGGCCTCCACATGGG - Intronic
940210218 2:151249120-151249142 GGTTCAAAGGGCCCCAACATGGG + Exonic
941454143 2:165695485-165695507 AGGTCTGAGGACCCACACAGTGG - Intergenic
946418929 2:219554094-219554116 TGGTCACGGGGCCCACACTTAGG + Intronic
946718077 2:222574474-222574496 GGGTCAGAAGGCCTTCACAGCGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1173434132 20:43017298-43017320 AGGTCACAGGGCCCAAACACAGG - Intronic
1175193450 20:57226381-57226403 GGGTCAGAGGGCCCACACATGGG - Intronic
1175918417 20:62438400-62438422 GGGTCAGGGGACCCCCACACCGG + Intergenic
1179174222 21:38995792-38995814 GGGTCTGCGGGTCCACACAGAGG - Intergenic
1179812696 21:43882744-43882766 GGGTCAGAGGGCCCTTGCTTGGG + Intronic
1181591620 22:23889098-23889120 GGGGCAGAGTGACCACACACAGG - Intronic
1183035914 22:35141074-35141096 GGGAGAGAGCGCCCCCACATGGG + Intergenic
1184744492 22:46448290-46448312 GGGGCAGAGGGCCCACGCGAGGG + Intronic
949162460 3:896397-896419 GGCTCAGAGGCCTGACACATAGG + Intergenic
954644380 3:52122026-52122048 GGGTCACAGGACCCAAACGTGGG - Intronic
956755149 3:72378446-72378468 GGGTCAGAGAGCACAGACAAGGG - Exonic
959145483 3:102539475-102539497 GTGTCAGGGGGCCCACATTTTGG + Intergenic
959618786 3:108377858-108377880 GGCTCAGAGGCCTGACACATAGG - Exonic
961653675 3:128429813-128429835 GTGTGTGAGTGCCCACACATAGG - Intergenic
962436743 3:135373937-135373959 AGGACACAGGGCCCAGACATAGG + Intergenic
963962289 3:151322940-151322962 GGGTCAAAGAGCCCACAGCTGGG - Intronic
968979719 4:3840527-3840549 GGGCCAGTGGGCCCACGCCTAGG + Intergenic
970664045 4:18317254-18317276 TGGCCACAGGGCCCACACTTTGG + Intergenic
971631498 4:28998765-28998787 GGGTCAGAGCTCCCACACAGAGG + Intergenic
971793635 4:31199516-31199538 GGGTCAGAGGCCCCACACAGAGG - Intergenic
972296748 4:37746323-37746345 GAGGCAGAGGGGCCACACACTGG + Intergenic
973816919 4:54627517-54627539 GGGTCATAGGACCCACAATTAGG + Intergenic
974341109 4:60615984-60616006 GGGTTGGAGGCCCCACACAGAGG + Intergenic
974964027 4:68737858-68737880 GGGTCAGAGAGCTCAGAAATTGG + Intergenic
976385048 4:84447369-84447391 GGTTCAGAGGGCCAGCACAGAGG + Intergenic
976635689 4:87284670-87284692 GGGTCAGAGCCACCACACAAGGG + Intergenic
981991720 4:150929484-150929506 GGCTCAGAGTGGTCACACATTGG + Intronic
988472969 5:31557777-31557799 AGGTCACAGAGCTCACACATGGG - Intergenic
990424682 5:55674570-55674592 AGGTCAAAGGGCCCACATGTAGG - Intronic
992747009 5:79829991-79830013 GGGTTAGATGGCTCACAGATGGG + Intergenic
997383355 5:133453449-133453471 TGGGCAGAGGGGCCTCACATAGG + Intronic
999919795 5:156305575-156305597 GGGTCAGAGCCCCCACACAGAGG + Intronic
1002454341 5:179337790-179337812 GGCTCACAGGGGCCACACCTGGG - Intronic
1002454363 5:179337889-179337911 GGCTCATAGGGGCCACACCTGGG - Intronic
1002458683 5:179361499-179361521 GTGTCAGAGGGCACGGACATAGG + Intergenic
1003012132 6:2435953-2435975 GGGTCAGAGGACACCCACAGAGG + Intergenic
1004427952 6:15518870-15518892 GGGTCAGCAGGCCCAGACATGGG - Intronic
1005499588 6:26418197-26418219 GGGTTAGAGCCCCCACACAGAGG - Intergenic
1006428219 6:33979276-33979298 GGGGCAGAGGGCACAGACAGGGG - Intergenic
1007702887 6:43774772-43774794 GGGTCACAGTTCCCACAAATGGG - Intronic
1009816937 6:68748741-68748763 GGGTGAGAGCCCCCACACAGAGG - Intronic
1013354187 6:109332802-109332824 GGGTATGAGTGCCCAGACATGGG - Intergenic
1016120847 6:140339748-140339770 GGGTGAGAGGGCCCACAGGTGGG + Intergenic
1018032081 6:159849364-159849386 GGGTCAGAGCCCCCACACAGAGG + Intergenic
1018927253 6:168215030-168215052 GGGACAGAGGCCCCACAGACAGG - Intergenic
1019026684 6:168971454-168971476 GGGTCAGGGCCACCACACATCGG - Intergenic
1023648267 7:42341959-42341981 GGGACAGAGGGCCCCCAAAAGGG + Intergenic
1023840922 7:44097061-44097083 GGGTCTTAGGGGCCACACAGAGG + Intergenic
1028226291 7:88255865-88255887 GGGTCAGAGGGCACACAATGTGG + Intergenic
1029424966 7:100489338-100489360 GGGTCAGGGGGCCTACAGTTGGG - Exonic
1029657323 7:101935817-101935839 GTGTCAGAGGGTGCACACTTGGG + Intronic
1030069939 7:105689669-105689691 GGAACAGAGGCCCCACACACAGG + Intronic
1031868570 7:127067137-127067159 GGGCAACAGGGCCCTCACATGGG - Intronic
1032408346 7:131674173-131674195 TGGTTAGAGAGCCCACACAGAGG + Intergenic
1037573497 8:20179125-20179147 TGGTGAGAGGGCCCACGAATGGG + Exonic
1042495015 8:69445991-69446013 GGGTCAGTGGGACCAGACAGTGG - Intergenic
1042976716 8:74478203-74478225 GGGGCAGAGTGCCCTCACACTGG + Intronic
1047542933 8:125787915-125787937 TGGTCAGGTGGCCCACACACTGG + Intergenic
1047966406 8:130049476-130049498 GGGGCAGAGGGGGAACACATGGG + Intergenic
1047966534 8:130049869-130049891 GGGGCAGAGGGGGAACACATGGG + Intergenic
1052986520 9:34491903-34491925 GGGTCAGAGTGCTAACACTTTGG - Intronic
1057033348 9:91796070-91796092 GGGTCAGAGGGCCTGGGCATCGG + Intronic
1057756875 9:97846322-97846344 GGGTCAGAGGACTAACACAGTGG - Intergenic
1060525734 9:124320315-124320337 GGCCCCCAGGGCCCACACATGGG + Intronic
1060765439 9:126292204-126292226 GGGGCAGAGGGTTCAGACATAGG - Intergenic
1062397851 9:136359680-136359702 GTCTCAGAGGGCCCAGACAGTGG - Intronic
1187972889 X:24676351-24676373 GGGTTAAAGGGCACAAACATAGG + Intergenic
1190259453 X:48788825-48788847 AGGTCAGAGGGCCCAAAGAGAGG + Intronic
1194253957 X:91613569-91613591 GGGTCAGAGCCCCCACACACTGG - Intergenic
1197214195 X:123852825-123852847 GGCTCAGAGGACCCAGACTTAGG + Intergenic
1197977659 X:132182649-132182671 TGGTCAGACTGTCCACACATGGG - Intergenic
1200048149 X:153413452-153413474 GGGTCCGAGGCCCCTCACAGAGG + Intergenic
1200572741 Y:4853146-4853168 GGGTCAGAGTCCCCACACACTGG - Intergenic