ID: 1175198939

View in Genome Browser
Species Human (GRCh38)
Location 20:57265399-57265421
Sequence CAAGGGCCGTTCAAAGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 23}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175198939_1175198958 30 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198958 20:57265452-57265474 TAACATGGAGGGGACTTCGGAGG 0: 1
1: 0
2: 0
3: 9
4: 75
1175198939_1175198952 15 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198952 20:57265437-57265459 ATGCGGCCGGCGGCGTAACATGG 0: 1
1: 0
2: 0
3: 0
4: 9
1175198939_1175198955 20 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198955 20:57265442-57265464 GCCGGCGGCGTAACATGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 18
1175198939_1175198948 5 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198948 20:57265427-57265449 AGCCCCAGAGATGCGGCCGGCGG 0: 1
1: 0
2: 1
3: 13
4: 171
1175198939_1175198946 2 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198946 20:57265424-57265446 TCCAGCCCCAGAGATGCGGCCGG 0: 1
1: 0
2: 0
3: 16
4: 215
1175198939_1175198944 -2 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198944 20:57265420-57265442 TGCCTCCAGCCCCAGAGATGCGG 0: 1
1: 0
2: 2
3: 44
4: 396
1175198939_1175198953 18 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198953 20:57265440-57265462 CGGCCGGCGGCGTAACATGGAGG No data
1175198939_1175198954 19 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198939_1175198957 27 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198957 20:57265449-57265471 GCGTAACATGGAGGGGACTTCGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175198939 Original CRISPR CAAGGGCCGTTCAAAGCGCG GGG (reversed) Intronic
903804828 1:25997823-25997845 CACTGGCCGTTAAAAGTGCGAGG + Intronic
904696834 1:32335845-32335867 CCCGGGCCGGACAAAGCGCGCGG + Intronic
913576104 1:120176677-120176699 CAATGGCCGCTCAAAGGGCGAGG - Intergenic
923435328 1:233962891-233962913 CAAGGTCCGTGCAAAGAGTGAGG - Intronic
924600168 1:245481838-245481860 CAAGGACTGTTCAAAGTGCCAGG - Intronic
1063355384 10:5394093-5394115 CAAGGGCCCTTCAAACCGGAGGG + Exonic
1064712399 10:18140644-18140666 CCAGAGCCGATCAGAGCGCGGGG + Intergenic
1076877897 10:133225567-133225589 CAAGGGCTGTTCTAAGCTGGGGG - Exonic
1105380656 13:19884323-19884345 CCAGGGCCTTTCAAAGTGCGGGG - Intergenic
1106086836 13:26550415-26550437 CAAGTGCAGTTCAAAGAGGGAGG + Intergenic
1121717001 14:96083520-96083542 CAAGGGCCCTTATAAGAGCGAGG + Intronic
1133618319 16:7500956-7500978 CAAGGGCCGAGCAAAGCAGGGGG - Intronic
1146110424 17:30084314-30084336 CAATGGCCCTTCAAAGCACATGG + Intronic
1148131781 17:45266652-45266674 CAAAGGCCTCTCAAAGCTCGCGG - Exonic
1160291487 18:77598641-77598663 TAAGGGCCCTTCAAAGCATGGGG + Intergenic
1175198939 20:57265399-57265421 CAAGGGCCGTTCAAAGCGCGGGG - Intronic
1179291443 21:40021390-40021412 CAAGGGCCGTTCAAAGTGGGTGG - Intronic
1182511520 22:30823257-30823279 CAAGGGCCCTTCCTAGCGTGGGG + Intronic
967100443 3:186211237-186211259 CAAGGGCCCTTCTAAGCACAAGG + Intronic
969280528 4:6167523-6167545 CATGGGCCCTTCAAAGCTCAGGG - Intronic
976097391 4:81523653-81523675 CAAAGGCCCTTCAAAGCCTGGGG + Intronic
985352248 4:189077332-189077354 TAAGGGCCGTTCAGACCGTGAGG + Intergenic
997460008 5:134045600-134045622 CAAGGGCCCTTCAAAGAGGGAGG - Intergenic
1004212890 6:13670037-13670059 CCTTGGCCTTTCAAAGCGCGGGG - Intronic
1018524099 6:164688613-164688635 CAAGGGCCTCTCAAAGTGCTGGG - Intergenic
1029988679 7:104943718-104943740 CAAGGGCCGTTCAAGGCCTGTGG - Intergenic
1032093695 7:128926586-128926608 CAAGGGCTGTTCAAAGTGGAGGG + Intergenic
1033389594 7:140913730-140913752 CCAGGGCCTTTCAAAGTGCTGGG + Intronic
1061545912 9:131304133-131304155 CAAGGGCCTTTCTAAGGGTGTGG + Intronic