ID: 1175198942

View in Genome Browser
Species Human (GRCh38)
Location 20:57265416-57265438
Sequence ATCTCTGGGGCTGGAGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 435}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175198942_1175198954 2 Left 1175198942 20:57265416-57265438 CCCTTGCCTCCAGCCCCAGAGAT 0: 1
1: 0
2: 2
3: 46
4: 435
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198942_1175198958 13 Left 1175198942 20:57265416-57265438 CCCTTGCCTCCAGCCCCAGAGAT 0: 1
1: 0
2: 2
3: 46
4: 435
Right 1175198958 20:57265452-57265474 TAACATGGAGGGGACTTCGGAGG 0: 1
1: 0
2: 0
3: 9
4: 75
1175198942_1175198952 -2 Left 1175198942 20:57265416-57265438 CCCTTGCCTCCAGCCCCAGAGAT 0: 1
1: 0
2: 2
3: 46
4: 435
Right 1175198952 20:57265437-57265459 ATGCGGCCGGCGGCGTAACATGG 0: 1
1: 0
2: 0
3: 0
4: 9
1175198942_1175198957 10 Left 1175198942 20:57265416-57265438 CCCTTGCCTCCAGCCCCAGAGAT 0: 1
1: 0
2: 2
3: 46
4: 435
Right 1175198957 20:57265449-57265471 GCGTAACATGGAGGGGACTTCGG 0: 1
1: 0
2: 0
3: 4
4: 87
1175198942_1175198953 1 Left 1175198942 20:57265416-57265438 CCCTTGCCTCCAGCCCCAGAGAT 0: 1
1: 0
2: 2
3: 46
4: 435
Right 1175198953 20:57265440-57265462 CGGCCGGCGGCGTAACATGGAGG No data
1175198942_1175198955 3 Left 1175198942 20:57265416-57265438 CCCTTGCCTCCAGCCCCAGAGAT 0: 1
1: 0
2: 2
3: 46
4: 435
Right 1175198955 20:57265442-57265464 GCCGGCGGCGTAACATGGAGGGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175198942 Original CRISPR ATCTCTGGGGCTGGAGGCAA GGG (reversed) Intronic
900994262 1:6111971-6111993 ACCTCTGGGGGTGGAGGCAGTGG - Intronic
902450680 1:16494930-16494952 AACTTTGGGGATGGAGCCAAGGG - Intergenic
902502185 1:16918412-16918434 AACTTTGGGGATGGAGCCAAGGG + Intronic
902837755 1:19057996-19058018 GTCTCTGGGCCAGGAGGCCATGG - Intergenic
902993220 1:20204143-20204165 ATCTGGGGGGCAGGAGGGAATGG + Intergenic
903070726 1:20725897-20725919 GTATCTGGGGCTTGAGGCAGGGG - Intronic
903076434 1:20770986-20771008 TTCTCTGGAGCTGGAGAGAAGGG - Exonic
903225924 1:21894257-21894279 ATCTCAGGGGCTGGAGTCCAGGG + Intronic
904097694 1:27994409-27994431 ACCTCTGGGGCTGAATGCAGTGG + Intronic
904705116 1:32384129-32384151 GTCTCTGGGGCTGCAGGAGAGGG + Intronic
905797855 1:40825576-40825598 AGGTCTGGGGCTGGAGGGAGGGG + Intronic
906074387 1:43041397-43041419 GTCTCTGGGGCTGTAGGGAGGGG + Intergenic
906111434 1:43324876-43324898 TTCTCTGTGGCTGGAGCAAAGGG + Intergenic
906312888 1:44766531-44766553 AACTCGGGGGGTGGAGGCTATGG + Intronic
907191066 1:52649425-52649447 AGCTCTGAGTATGGAGGCAAGGG + Intronic
907469494 1:54664079-54664101 ATCGCTGTGGCTGGAGGCATGGG + Intronic
909001334 1:70221281-70221303 ATTTCTCGGGCTGCAGGCGACGG + Intronic
910803513 1:91167680-91167702 ATCAGTGTGGCTGGAGGCTAAGG - Intergenic
910830568 1:91457028-91457050 ATGTATGGGCTTGGAGGCAAAGG + Intergenic
912404903 1:109428976-109428998 TTATCTAGGGCTGGAGGAAAAGG + Intergenic
913129167 1:115823662-115823684 ATATCTGAGGCTGGATGCAGTGG + Intergenic
914389587 1:147207853-147207875 ATCCCTGGGTCAGGAGGTAATGG + Intronic
916242002 1:162649600-162649622 AACTCTGGTGGTGGAGGCAGTGG + Intronic
916575582 1:166063898-166063920 ATATGTGGGCCTGGAGGCAGAGG + Intronic
916686487 1:167152053-167152075 ATCTCTGTTGCTGGAGTCAGAGG - Intergenic
916919583 1:169449855-169449877 ATCTGTGAGGCTGCAGCCAAAGG - Intronic
917474031 1:175352936-175352958 CTCTCTGGGGATGGAGGAAGAGG + Intronic
917669100 1:177255980-177256002 AACTCTGGGGCAAGAGGCAATGG - Exonic
918066765 1:181106599-181106621 CTCTCTAGGGCTGGTGCCAAAGG - Intergenic
918932147 1:190868254-190868276 ATATAGGGGGCTGGAGGAAATGG - Intergenic
919420032 1:197358537-197358559 ATCTCTGTGGCTTAATGCAATGG + Intronic
919593935 1:199538242-199538264 CTCTCTGTTGCTGCAGGCAATGG - Intergenic
920381515 1:205537117-205537139 ATCTCAGGGACTGGAGGCTTGGG - Intergenic
920524823 1:206658974-206658996 ATCTCTGAGGCAGAAGGCACTGG - Intronic
920852342 1:209636640-209636662 ATGACTGGGGTTGGGGGCAAGGG - Intronic
920950408 1:210567000-210567022 TTCTATGGGGCTGGAGCCCAGGG + Intronic
922124794 1:222712048-222712070 CTCGCTGGGGCTGGTGGCGAGGG + Intronic
922465697 1:225844651-225844673 GCCTCTGAGGCTGGAGGCAGGGG + Intronic
922471515 1:225880035-225880057 ATGACTGGGGCTGGAGGGAGGGG - Intronic
922569898 1:226628240-226628262 ATCTTGGGGGCTAGAGCCAAGGG + Intergenic
922571718 1:226638319-226638341 AGCTCTGAGGCTGCAGGCAGGGG - Intronic
922977482 1:229797756-229797778 ATCTGTGGGGCTGGAGGGGTGGG + Intergenic
922988748 1:229886907-229886929 GGCTCTGGGGCGGGGGGCAACGG + Intergenic
923030422 1:230245174-230245196 ATCACAGGGGCTGGACGCAGTGG + Intronic
923511255 1:234655735-234655757 ATCTGTGGAGCTGGAGGCCTTGG - Intergenic
923534269 1:234836835-234836857 ATTTTTGTGGATGGAGGCAAGGG - Intergenic
923562141 1:235049439-235049461 TGCACTGGGGCTGGTGGCAATGG + Intergenic
1062932091 10:1360242-1360264 ACCTCTGGGGCTGGGGGGAAAGG - Intronic
1063123743 10:3122874-3122896 GCATCTGGGGCTGGAGACAAGGG + Intronic
1063132834 10:3193431-3193453 TTGTCTGGGGCAGGAGGCAGAGG - Intergenic
1064038883 10:11940546-11940568 ATCTCTGGGACAGGAAACAAGGG - Intronic
1064261723 10:13791589-13791611 ATCTCAGAAGCTGGAGGAAATGG + Intronic
1064533629 10:16335502-16335524 CTCTCTGGGGGTAGAGGCCATGG - Intergenic
1064949806 10:20835886-20835908 TTCTTTGGGGCTGGAGGATAGGG + Intronic
1065844968 10:29736439-29736461 ATCCCAGGGGCTGGAGGCCAGGG + Intronic
1065884390 10:30064090-30064112 ATCTCTTGGGCTGGGCGCAATGG - Intronic
1067829873 10:49605409-49605431 TTGTCAGGGTCTGGAGGCAAGGG + Intergenic
1067897265 10:50196974-50196996 ATTTCTGGGTCTGGAGGCCTGGG - Intronic
1067951707 10:50745051-50745073 ATTTCTGGGTCTGGAGGCCTGGG + Intronic
1068617219 10:59132271-59132293 TTCTCTGGGGCTGGAGGTATGGG - Intergenic
1069505972 10:68998236-68998258 ATCTTTTGGGCTGGGTGCAATGG - Intronic
1070031991 10:72685921-72685943 ATTTTTGGGGCTGGATGCAGTGG - Intergenic
1070109498 10:73470105-73470127 ATCTCTGGAACGGAAGGCAAAGG + Intronic
1070642845 10:78181610-78181632 CCCTCTGGGGCTTGAGGCCAGGG + Intergenic
1070984987 10:80680974-80680996 GTCTGTGGGGCAGGAGTCAAGGG + Intergenic
1072147607 10:92656334-92656356 ATCTCTGGGGCTGGATGTGGTGG - Intergenic
1072163612 10:92790699-92790721 ATCACTGAGGCTGTAGGAAATGG + Intergenic
1072740771 10:97907817-97907839 CTCCCTGTGGCTGGAGCCAAGGG + Intronic
1073176403 10:101560076-101560098 AGCTGTGGGGCTGCAGGGAAGGG - Intergenic
1074180244 10:111055874-111055896 AACTCTGGGGTTTGAGACAAGGG - Intergenic
1075090829 10:119443531-119443553 ACCTCTGGAGCTGGGGGCAGAGG - Exonic
1075277601 10:121108700-121108722 ATCACTGGGGCTGGAGTTACAGG + Intergenic
1076804252 10:132847273-132847295 GTCTCTGGAGCTGGAGGTAGAGG - Exonic
1077225761 11:1438472-1438494 AGCACAGGGGCTGGAGGCCAGGG + Intronic
1079055959 11:17207356-17207378 ATCTCTGGCTCTGGGGGCCAAGG - Intronic
1079064237 11:17276149-17276171 TTCTCTGGGGCAGGATGCAGAGG + Intronic
1079186708 11:18244915-18244937 ATCTCTGTTTCTGGAGGCAGGGG - Intronic
1079455860 11:20635811-20635833 ATCTAGTGGGGTGGAGGCAAGGG - Intronic
1079617996 11:22518836-22518858 ATGACTGGGGCTGGGTGCAATGG + Intergenic
1080190999 11:29549226-29549248 TTTCCAGGGGCTGGAGGCAATGG - Intergenic
1080194807 11:29596863-29596885 CTATCTGGGGCTGGTGGCACAGG + Intergenic
1080268734 11:30427763-30427785 ATCTCTGGGGGTGAAGGGAGAGG + Intronic
1080394220 11:31875126-31875148 GTTTCTGGGGCTGGAGGAAGGGG - Intronic
1080401844 11:31943434-31943456 CTCTCTGAGGCTACAGGCAAAGG + Intronic
1080858006 11:36129105-36129127 ATCTCTCGAGCTGGAGGCAGGGG - Intronic
1080942007 11:36929329-36929351 ATCTTTGGGTGGGGAGGCAATGG + Intergenic
1080950765 11:37030125-37030147 CTCTCAGGGGCTGGGGGCAAGGG - Intergenic
1081043951 11:38249391-38249413 TTCTCTGGGGATGCAGGCTAGGG + Intergenic
1081856840 11:46309264-46309286 CTCTCTGGGGCTGCAGCCCAGGG + Intronic
1083096111 11:60253396-60253418 ACCTCTGGGGAAGGAGGCAGGGG - Intergenic
1083478388 11:62928245-62928267 AGCTCTGCAGCTGGAGGCCAGGG + Intergenic
1084084681 11:66849557-66849579 AGCTCTGGGGCAGGGGGCCAGGG + Intronic
1084579509 11:70014337-70014359 CTCTATGGTGTTGGAGGCAAAGG - Intergenic
1084588064 11:70074724-70074746 CACACTGGGGCTGGAGGCAGAGG + Intergenic
1084710305 11:70840035-70840057 AGCCCTGGGGCTGAAGGCAGAGG + Intronic
1084887048 11:72217521-72217543 ATGGCTGGGGGTGGGGGCAAGGG + Intronic
1084951001 11:72665410-72665432 AGGTTTGGGGCTGGAGGCAGGGG - Intronic
1085451881 11:76639049-76639071 AGCTCAGGGGCTGGAGGCAGGGG - Intergenic
1085595707 11:77807705-77807727 ATCTCTGGGGATTGAGGCCCTGG - Intronic
1085621342 11:78040122-78040144 ACTTCCGGGGCTGCAGGCAAGGG + Intronic
1085944854 11:81256561-81256583 AACTCTGGGGGTGGAGCAAAGGG + Intergenic
1086111110 11:83199248-83199270 ATCTCTGGAGTTGGAAGCAGAGG - Intronic
1087777332 11:102268526-102268548 TTCTGCGGGGCTGGAGGGAACGG + Intergenic
1088809637 11:113382620-113382642 ATGTCTGAGGCTGGAGACGATGG - Intronic
1089339121 11:117745556-117745578 TTCACTGGGGCTGGGGGCTATGG + Intronic
1089979507 11:122760646-122760668 TTCTCTGGGGCTGGGTGCAGTGG - Intronic
1090327248 11:125899748-125899770 ATCTCTGGGACTTAAGACAAAGG + Exonic
1090456455 11:126854387-126854409 TTGTCAGGGGCTGGAGGTAATGG - Intronic
1090957426 11:131525675-131525697 ATCACTGGGGCATGAGGTAATGG + Intronic
1091391981 12:131319-131341 GTCTCTGGGCCTGTAGGCCAGGG - Intronic
1091741744 12:2964254-2964276 ATCTCAGGGGCTTGAGGGGAAGG - Intronic
1093214580 12:16348021-16348043 AACTCTGGGGAAGGAGGAAAAGG + Intronic
1095626137 12:44317804-44317826 GTCTCTGATGCTGCAGGCAATGG + Intronic
1096068219 12:48758013-48758035 ATATGTGGGGCTGGATGCAGTGG + Intergenic
1096085899 12:48864994-48865016 ATGCCTGGGGCAGGAGGGAAGGG + Intronic
1096576167 12:52554200-52554222 GTCTCTGGGGCTGGCATCAAAGG - Intergenic
1096717542 12:53500248-53500270 AACTTTGGGGGAGGAGGCAATGG + Intergenic
1097122369 12:56744802-56744824 ATTTCTAGGGCTGGACGCAGTGG + Intronic
1097395421 12:59067382-59067404 CTCTCTGGGGCTGGGGGCTGGGG + Intergenic
1097820011 12:64118992-64119014 ATATATGGGGCTGGATGCAGTGG - Intronic
1098237009 12:68427015-68427037 CTTTCTGGGGCTGGACTCAAAGG + Intergenic
1098650354 12:72958932-72958954 ATCTCTGGGGGTGGGGGGTAAGG - Intergenic
1100386056 12:94105352-94105374 CTCTGTGGGGATGGAGGCATGGG + Intergenic
1101237257 12:102802265-102802287 ATCTCAGGGGCTGGAAGCCAAGG + Intergenic
1101657303 12:106734152-106734174 ATGTCAGGGGCTGGAGGGAAGGG + Intronic
1101845203 12:108358028-108358050 ATCTCTTGGGGTGGAGCCCAGGG + Intergenic
1103335224 12:120184240-120184262 ATCTCTAGGGGGAGAGGCAAAGG + Exonic
1103380312 12:120489031-120489053 TTCTCTGGGGCAGGTGCCAAAGG + Intronic
1104340187 12:127941965-127941987 TTCACTGGGGCAGGAGGCAGAGG + Intergenic
1104425581 12:128674816-128674838 ATTTTGGGGGCGGGAGGCAAGGG - Intronic
1104473618 12:129052129-129052151 ATCTCTGGGGAAGAAGGCATGGG - Intergenic
1104539383 12:129648352-129648374 ATTTCTAGGGCAGGGGGCAAGGG - Intronic
1106386160 13:29288223-29288245 GGCTCTGGGAATGGAGGCAATGG + Intronic
1106559787 13:30838322-30838344 ATCCCTGGGGCTGGGAGCATGGG + Intergenic
1107136462 13:36949415-36949437 ATCTCTAGCACTGGAGGCCAAGG - Intergenic
1107462396 13:40616722-40616744 ATCTGTGAGGCTGCATGCAAGGG + Intronic
1107959508 13:45545701-45545723 AGCTCTGGGGCTGGTGGGACAGG - Intronic
1107997483 13:45874997-45875019 CTCTGAGGGGATGGAGGCAAGGG - Intergenic
1108492285 13:50993611-50993633 ATCCCAGGGCCTGGAGACAAAGG - Intergenic
1108531632 13:51332097-51332119 ATCCCAGGGGCTGTAGGCACAGG - Intergenic
1108587265 13:51881237-51881259 TTCTCTGGGGCTGTAGGAACAGG + Intergenic
1109212433 13:59549123-59549145 ATCTGTGGGGCTGGAGTCCTAGG - Intergenic
1110242272 13:73282540-73282562 AGCTCTGGGGCAGCAAGCAAAGG - Intergenic
1110429504 13:75407596-75407618 ATCTCTGAGGAAGGATGCAAAGG + Intronic
1111634661 13:90888716-90888738 TTATTAGGGGCTGGAGGCAAGGG - Intergenic
1112280210 13:98056261-98056283 ATCTCAGGGCCTGGAGGAAGAGG + Intergenic
1112869047 13:103947082-103947104 CTCTCTGTGGCTGGATGCAGTGG + Intergenic
1113210234 13:107970016-107970038 ATCTCTTTGGCTGGATCCAAGGG + Intergenic
1113608584 13:111627511-111627533 AGGGCTGGGGCGGGAGGCAAGGG - Intronic
1113951697 13:114075467-114075489 ATCTCTGCGTGTGGAGGCACCGG + Intronic
1113951709 13:114075521-114075543 ATCTCTGGGTGTGGAGGCGCCGG + Intronic
1113951751 13:114075737-114075759 ATCTCTGGGTGTGGAGGCGCCGG + Intronic
1113951793 13:114075953-114075975 ATCTCTGGGTGTGGAGGCGCCGG + Intronic
1114567115 14:23640767-23640789 ATCTCTGAGGATGTAGCCAAGGG - Intronic
1116037323 14:39643077-39643099 AATTCTGGGGGTGGGGGCAATGG + Intergenic
1116791400 14:49343873-49343895 ATATATGGGGCTGGATCCAAAGG + Intergenic
1117279197 14:54220613-54220635 TTCGCTGGGGCTGGAGGGAGGGG + Intergenic
1117644151 14:57833508-57833530 ATCTCTGGGGCTCAAGGCCTGGG + Intronic
1117798613 14:59420282-59420304 TTGTCTAGGGCTGGAGGGAAGGG - Intergenic
1117826979 14:59714193-59714215 GTCACTTAGGCTGGAGGCAATGG - Intronic
1118074560 14:62283892-62283914 TTCTCTGTGGCCTGAGGCAAGGG + Intergenic
1119418186 14:74489660-74489682 GTCTCTGGGGCAGGAGGAAATGG - Intronic
1120548816 14:85844283-85844305 ATTACTGGGGCAGGAGACAAAGG + Intergenic
1120875922 14:89375855-89375877 ATCTGGGGGGCTGGGGGCAGAGG - Intronic
1121441390 14:93951937-93951959 AACTCTGGGGCCAGAGCCAAGGG - Intronic
1122145422 14:99685753-99685775 ATCTCTGTGGCTGGTGACATAGG + Intronic
1122300788 14:100729973-100729995 CTTTCTGGGGCTGGGGGAAAGGG - Intronic
1122575368 14:102738533-102738555 CTCTCTGGGGCTGAAGGCACAGG + Intergenic
1122797055 14:104211264-104211286 ATCTGTGAGGCTGGAGCCACGGG - Intergenic
1123102874 14:105817807-105817829 CTCTTTGGGGCTGGAGACTATGG + Intergenic
1123164235 14:106310017-106310039 ATTTCTGGGTCTGGATGCACAGG + Intergenic
1123712143 15:22996355-22996377 ATGTCTTGGGCTGGGTGCAATGG + Intronic
1124461543 15:29896787-29896809 ATCTCTAGGGCAGGAGCAAAAGG - Intronic
1125048588 15:35271721-35271743 ATCTCTGGGGCTGAGGGCTGGGG + Intronic
1125551117 15:40545589-40545611 AAGGCTGGGGCTGGAGGCTAGGG + Intronic
1126096716 15:45095482-45095504 GTCTTTGAGGATGGAGGCAAAGG + Exonic
1128939137 15:71772919-71772941 GTATCTTGGGCTGGATGCAATGG + Intronic
1129002380 15:72345541-72345563 TGCTCTGGGCCTGGAGGAAAAGG + Exonic
1129426963 15:75470441-75470463 AAATCTGGGGCTGGGTGCAATGG - Intronic
1129776617 15:78241173-78241195 GTTTCTGGGGATGGAGGCAGTGG - Intronic
1129789759 15:78332883-78332905 ATCTCTGGAACTTGAGGCCAGGG - Intergenic
1132880835 16:2161066-2161088 GACCCTGGGGCTGGAGGCCAGGG - Intronic
1132981502 16:2740593-2740615 GTCTCTGGGGATGGAGGCTGAGG - Intergenic
1133055391 16:3143226-3143248 ATGTCAGGGGCTGGTGGGAAGGG - Intergenic
1133116913 16:3582727-3582749 GTCTCAGGGGCTGGAGAGAAAGG - Intronic
1133221559 16:4321139-4321161 CTATCTGGGGCTGGGGGCCAGGG + Intronic
1135751955 16:25065384-25065406 ATCTCTGGGGGTGGGGACAGGGG + Intergenic
1136229783 16:28879482-28879504 TTCCCTGGGGGAGGAGGCAAGGG - Exonic
1136499382 16:30662479-30662501 AGGTCTGGGGCTGGAGGCACGGG + Intronic
1137731181 16:50691748-50691770 ATCTCTGGTGCCAGAGGAAAGGG + Intergenic
1137925016 16:52532338-52532360 ATTTCTGGGCCTGGACTCAAGGG + Intronic
1138525121 16:57600689-57600711 TCCTCTGAGGATGGAGGCAAGGG - Intergenic
1139970475 16:70771079-70771101 ATCTCTGGGGCTAGAGTGGATGG - Intronic
1140875818 16:79151806-79151828 AACACTGGGGCTGGAGGCCATGG - Intronic
1142318163 16:89362497-89362519 ATCTCTGGTGCTGGACACATGGG - Intronic
1142761190 17:2042711-2042733 ATCACTGGGGATGGTGGCACAGG + Exonic
1143333365 17:6154528-6154550 CTGTCTGGGGGTGGGGGCAAGGG + Intergenic
1143886973 17:10072154-10072176 ATCCCTAGGGCTGGAGGTAGGGG + Intronic
1144512682 17:15890977-15890999 ATATCTGTGGCTGGATGCAGTGG + Intergenic
1144789658 17:17850357-17850379 ATCTCTGAGGATGGAGACAATGG + Intronic
1144948312 17:18981073-18981095 ATCTCTGCAGCTGGAGGCCTCGG - Intronic
1145123471 17:20281360-20281382 AACTCTGGGGCTTCAGGAAAGGG - Intronic
1145261657 17:21358108-21358130 ATCTCTGAGGCAGGTGGTAATGG + Intergenic
1145266980 17:21384475-21384497 AGCTCTGGGGATGGAGGCAGGGG - Intronic
1145769215 17:27480208-27480230 CACTCTGGGAGTGGAGGCAAGGG - Intronic
1145908655 17:28530029-28530051 ATGTCAGGGGTTGGGGGCAAGGG + Intronic
1146649686 17:34598934-34598956 ATATCTGAGGCTGGGGGCCAGGG - Intronic
1147466586 17:40615619-40615641 ATTCCTGGGGCTGGAGGGAAGGG + Intergenic
1147503223 17:40986611-40986633 CTATCTGGGGCTGGTGGCATGGG - Intronic
1147564704 17:41528992-41529014 ATCACTGGGGCTGGGCGCAGGGG - Intergenic
1148090591 17:45020562-45020584 ATCTGAGGGCCTGGAGGCTAGGG - Intergenic
1148181357 17:45607339-45607361 AACTGTGGGGCTGGATGCGATGG - Intergenic
1148267555 17:46238605-46238627 ACCTGTGGGGCTGGATGCGATGG + Intergenic
1148750181 17:49941051-49941073 ATGCCTGGTGCTGGTGGCAAGGG + Intergenic
1150484249 17:65532982-65533004 TTCTCTTGGGCTGCAGGCCATGG + Intronic
1150837918 17:68581177-68581199 ATCTCTGGGCCCTGATGCAAAGG + Intronic
1151560420 17:74866755-74866777 GTCTCTGGGCCTGGAGGCTGGGG - Intronic
1151585272 17:75004823-75004845 ATTTCTGGGGTTGGAAGCCAAGG - Exonic
1151718566 17:75843631-75843653 ATCACTGGGGCTGGAGGCCGGGG - Intronic
1152301227 17:79496134-79496156 CCCTCTCGGGCTGGAGGCCAGGG + Intronic
1153546906 18:6217315-6217337 ATCTCTGTGGTTGGAAGCGAGGG - Intronic
1153886621 18:9473844-9473866 ATCTCTGCTGCTAGAGGGAATGG + Intergenic
1154473124 18:14723988-14724010 TTGTCTGAGGCTGGGGGCAAAGG - Intergenic
1155200446 18:23512904-23512926 ATTGCTGGGGCTGCAGGGAAGGG - Intronic
1155803241 18:30135491-30135513 ACATCTGGGGCTGGATGCAGTGG - Intergenic
1159660383 18:71089048-71089070 CTGTCTGGGGGTGGGGGCAAGGG - Intergenic
1160125814 18:76170301-76170323 ATATCTGGGGGTGGAGGGAGGGG + Intergenic
1161290666 19:3492009-3492031 ATCACTGGGGCTGGGGGCAGGGG - Intronic
1161303487 19:3554792-3554814 AAGTCTGGGGCTGGTGGCTAAGG - Intronic
1161380760 19:3963910-3963932 ATCTCTGGGGCTGCAGAACAGGG + Exonic
1161465808 19:4429654-4429676 GTCTTTGGGGCTGGAGGAAAGGG - Intronic
1162465181 19:10835513-10835535 ATCAATGAGGGTGGAGGCAAGGG - Intronic
1162792783 19:13071760-13071782 ATGTCTGGGGCTGAAAGCACTGG - Intronic
1163147061 19:15387250-15387272 GGCTCTGGGGATGGAGACAATGG - Intronic
1163492905 19:17627478-17627500 ATCTCCAGGGCTGGGGGCAGTGG - Intronic
1163749490 19:19067297-19067319 ATATTTGGGGCTGGATGCAGTGG + Intronic
1163821412 19:19498614-19498636 ATCTCTGGGGCTGGGGGCTTGGG - Exonic
1164532531 19:29059185-29059207 ATCTGTGGGTCTGGAGGAAGTGG - Intergenic
1165065867 19:33227276-33227298 GTCTCTGGGGCTGGAGGTGGAGG - Intergenic
1165724505 19:38103337-38103359 ATATATGGGGCTGGGCGCAATGG + Intronic
1165831843 19:38734361-38734383 CTCTCTGGGGGTGGAGGTATGGG + Exonic
1165947333 19:39452057-39452079 ATATATGGGGCTGGGGGAAAAGG + Intronic
1166334426 19:42096550-42096572 TTCCCTGGAGCTGGAGGCAGTGG + Intronic
1166369959 19:42295084-42295106 GACTCTGGGGGTGGAGGCAGTGG - Exonic
1166851641 19:45764207-45764229 TTCTCAGGGGCTGGAGGCCCAGG - Exonic
1167029791 19:46950538-46950560 ATCTCTGAGGCTGATGGCAGAGG + Intronic
1167668254 19:50835528-50835550 ATTTGTGGGGAGGGAGGCAAAGG - Intronic
1167707544 19:51090502-51090524 TTCTCAGGGGGTGGAGACAAGGG + Intergenic
1167996801 19:53411577-53411599 ATCACTGGGGCTGGGCGCAGTGG - Exonic
1168123789 19:54271585-54271607 ATCTCCAGGGCTGGATGCCATGG - Intronic
1168178568 19:54643945-54643967 ATCTCCAGGGCTGGATGCCATGG + Intronic
925227128 2:2193044-2193066 ATCACTGAGGCAGGAGGCAGAGG - Intronic
925265613 2:2564404-2564426 CTCTTCGGGGCTGGAGACAATGG + Intergenic
925395368 2:3529718-3529740 AGCTCTGGGCCTGGCGGCACTGG + Intergenic
926588433 2:14714716-14714738 ATCTCTGTGTCTGGAGTGAAGGG + Intergenic
927085481 2:19671049-19671071 GTCTCTGAGGATGGAGGGAAGGG - Intergenic
927101461 2:19790573-19790595 CTCACAGGGGGTGGAGGCAAAGG - Intergenic
927869168 2:26612945-26612967 ATCTAGGGGAATGGAGGCAAAGG - Intronic
927949060 2:27155225-27155247 GTCTCTGTGGCTGGAGGAGATGG - Exonic
928366207 2:30705492-30705514 AGCTCAGGGGCAGGAGGCCAGGG + Intergenic
929542055 2:42830040-42830062 AGCCCTGGTGCTGGAGGCAGAGG + Intergenic
932568386 2:72923889-72923911 ATCGTTGGGGCTGGCGGCCAGGG + Intronic
932619449 2:73257180-73257202 TGCTCTGGGGTAGGAGGCAAGGG + Exonic
934035459 2:88085336-88085358 ATCTCTTGGGCTGGAGCTATAGG - Intronic
934779302 2:96959595-96959617 CCCTGTGGGGCTGGAGGCCAGGG - Intronic
934988267 2:98902644-98902666 ATCCCTGGAGCTGGAGGGAAGGG + Intronic
935069649 2:99682694-99682716 ATCACAGGGGCTGGAGGCCTGGG + Intronic
937089532 2:119196692-119196714 TTCTCTGGGGCGGGAGGAGAGGG + Intergenic
937880198 2:126858886-126858908 TTCTCTGGGGCAGGAGGGAGGGG - Intergenic
938408912 2:131047733-131047755 GTCACTGGGGCTGGACGCCATGG + Intergenic
938509583 2:131926360-131926382 TGCTCTGGGGCTGGAGACCAGGG + Intergenic
938739069 2:134213938-134213960 ATCTCTGGGGAGGGAAGAAAGGG - Intronic
939561982 2:143743017-143743039 AGCTCTGGGTCTAGAGACAAGGG + Intronic
939934040 2:148267578-148267600 ACCTCTGGAGAGGGAGGCAAGGG - Intronic
941730652 2:168913374-168913396 ATTACTGAGCCTGGAGGCAAGGG - Intergenic
942398527 2:175577069-175577091 ATCAGTGGGGGTGGAGGCGAGGG - Intergenic
943410628 2:187542581-187542603 ATTTCTGGGGCTGGACGCTGCGG + Intronic
944098689 2:195997895-195997917 ATCTCTGGGGCAAGGGACAATGG + Intronic
945999861 2:216473106-216473128 AACTCTGGGGGTGGGGGCAGCGG - Intronic
946164798 2:217857425-217857447 ATGGCTGGGGCTGGAGGCATTGG + Intronic
947334718 2:229069437-229069459 ATCTATGGGACTTTAGGCAATGG + Intronic
949054749 2:241921766-241921788 ATCTCTGGGACAGGAGGCCAGGG + Intergenic
949054843 2:241922087-241922109 ATCTCTGGGACAGGAGGCCAGGG + Intergenic
1169064862 20:2689414-2689436 TTCTCTGGGGCTGCAGGCTCTGG + Intergenic
1169911123 20:10648175-10648197 TTCTCTGGGGCAGCAGGCACTGG + Intronic
1170180734 20:13527102-13527124 AACCCTGGGGCTGTGGGCAATGG + Intronic
1171183367 20:23107518-23107540 AGTTCTGGGGCTGAAGGCTAGGG - Intergenic
1172971824 20:38879211-38879233 ATCTCAGAGACTGAAGGCAAGGG - Intronic
1173761399 20:45563873-45563895 ATCTCGTGGGATGGAGGCAGGGG + Intronic
1174118041 20:48241398-48241420 ATCTCTTGAGCTGGAGCCAGAGG - Intergenic
1174317178 20:49712782-49712804 GTCTGGGGGGCTGGGGGCAAAGG + Intronic
1174505960 20:51017753-51017775 CTCCCAGGGGCTGGAGGCACAGG + Intronic
1174687233 20:52467713-52467735 CTCTCGGGGGATGGGGGCAAGGG - Intergenic
1174971516 20:55281209-55281231 TTCTCTGGGGCAGGAGGCTGGGG - Intergenic
1175198942 20:57265416-57265438 ATCTCTGGGGCTGGAGGCAAGGG - Intronic
1175696599 20:61107336-61107358 ATCTCTGCTGCTGGACGCAACGG + Intergenic
1175757530 20:61538999-61539021 GTCTCTGCCGCTGGAGGCAGGGG + Intronic
1175760474 20:61559374-61559396 ATCACTGGGGCTGGACCGAAGGG + Intronic
1176801358 21:13433861-13433883 TTGTCTGAGGCTGGGGGCAAAGG + Intergenic
1177822888 21:26050968-26050990 ATCTCTGAGGCTGAACACAAAGG + Intronic
1179315043 21:40236508-40236530 ATCTCAGGTGCTGTAGTCAAAGG + Intronic
1179803848 21:43825100-43825122 ATCCCTGGGGCAGGAAGCCAAGG + Intergenic
1179965478 21:44802197-44802219 CGGTCTGGGGCTGGAGACAAGGG + Intergenic
1179988725 21:44934816-44934838 ATCCCTGGGGCTGGAGCTATGGG - Exonic
1180610128 22:17090830-17090852 ATCTCTGGGGCAGGAGGGGAGGG - Intronic
1181580912 22:23827601-23827623 ATCTTTGGGGTTAAAGGCAAAGG + Intronic
1181801871 22:25353043-25353065 ATCCCTGAGCCTGGAGGCAGAGG - Intronic
1182547805 22:31085740-31085762 CCCTTTGGGCCTGGAGGCAAAGG - Intronic
1183282959 22:36942503-36942525 CTCTCTGGGTCTGGTGGCACAGG + Intergenic
1183584744 22:38746422-38746444 AGCTCTGGGGCAGGTGGCAGGGG + Intronic
1183764327 22:39857153-39857175 ATCTGTGGGGCTGGGCGCAGTGG + Intronic
1183980799 22:41538973-41538995 GTCTTTGGGGCTGGGGGCAGTGG + Intronic
1184037454 22:41925545-41925567 GGCTCTGGGGCTGCAGGCAGAGG + Exonic
1184285447 22:43468522-43468544 ATCTCTGAGGCAGGAGGCCAGGG + Intronic
1184687706 22:46104046-46104068 ACCTCTGGGGGAGGTGGCAAGGG - Intronic
1184735350 22:46394712-46394734 ATCTGTGGGTCTGGGGGCCAGGG - Intronic
1185102487 22:48849082-48849104 CTCACGGGGGCTGGAGGCAGCGG + Intronic
950586233 3:13894624-13894646 ATGTCTGGAGCTGGAGGGCAAGG + Intergenic
951784801 3:26406030-26406052 CTATCTGGGGCTGGTGGCACAGG + Intergenic
953125559 3:40088694-40088716 ATCTCTGTGGCTGGAGCCTGTGG + Intronic
953584328 3:44186176-44186198 ATCTCTGGAGCTTGAGGTCAGGG + Intergenic
953608702 3:44429270-44429292 AGCTCTGGGGCTGGTGGGAGTGG - Intergenic
954466775 3:50659829-50659851 AACTCTGGGGCTGGCTGCTACGG + Intergenic
954749476 3:52805609-52805631 CTTTATGGGGCTGGTGGCAATGG - Intronic
955628525 3:60947075-60947097 ATCTCTGAGTCTTGAGGAAAAGG + Intronic
956736453 3:72242336-72242358 CTGTGTGGGGCTGGAGGCAGGGG - Intergenic
958080195 3:88737422-88737444 ATTTATGGGGATGGGGGCAAGGG - Intergenic
958435882 3:94095338-94095360 ATCACTGGGGGTGGAGGGAGGGG - Intronic
958467680 3:94477773-94477795 TTCTGTGGGGTGGGAGGCAAAGG + Intergenic
959079985 3:101789976-101789998 ATATATGGGGCTGGATGCAGTGG - Intronic
959719685 3:109472474-109472496 AGGTCCAGGGCTGGAGGCAAAGG - Intergenic
960995398 3:123336916-123336938 ATCTCTGGGGCTGGGGGTAGGGG - Intronic
962388487 3:134952431-134952453 AGCTCTGGGGCTGGAGACTTTGG + Intronic
962541013 3:136382205-136382227 ATCTTAGGAGTTGGAGGCAAAGG + Intronic
964624592 3:158747161-158747183 ATCTCTGGGGCTTGAGGTCCTGG + Intronic
965362280 3:167756051-167756073 CTCTCTGGGGTTGGGGGCAGGGG - Intronic
965821018 3:172684691-172684713 ATCTTTTGGGCTGGGTGCAATGG + Intronic
966165062 3:177007929-177007951 TTCCCGGGAGCTGGAGGCAAAGG - Intergenic
966797381 3:183728483-183728505 ATAGCTGGGGCTGGATGCAGTGG - Intronic
967272466 3:187742767-187742789 GTCTCTGGGGGAGGAGGAAATGG - Intronic
968451189 4:676780-676802 AACCCTGGGGCTGGGAGCAAGGG - Intronic
968563633 4:1297891-1297913 ATCGCGAGGGGTGGAGGCAAGGG - Intronic
969424515 4:7116314-7116336 ATGTCTGGGGCAGGGGCCAAGGG + Intergenic
969845465 4:9916917-9916939 TGCTCTGGTGCTGGAGGCACAGG + Intronic
971899165 4:32635950-32635972 CTTTCTGGGGTTGGGGGCAAGGG + Intergenic
972475885 4:39449035-39449057 AACTCTGGGGCTGGACGCTGTGG + Exonic
974826258 4:67134472-67134494 ATGCCTGGGGCTGGGGTCAAGGG - Intergenic
976727355 4:88227605-88227627 ATCTCTGGAGTTGGAGCCCAAGG + Intronic
977826959 4:101544162-101544184 AACTCTGAGGCTGGACGCAGTGG + Intronic
980979648 4:139643278-139643300 TTCGCTGTGGCTGGAGCCAAGGG - Intergenic
982048574 4:151475505-151475527 ATATCTGGGGATGGAGGCTCCGG + Intronic
982093190 4:151897760-151897782 ATCCCTGGGGCTGATGGTAAAGG + Intergenic
982726246 4:158909753-158909775 AAATTTGGGGCTGGACGCAATGG + Intronic
983069942 4:163256116-163256138 AGCTCTGGCCCTGGAGTCAAGGG - Intergenic
983163853 4:164451116-164451138 AATTCTGGGGCTGGGTGCAATGG + Intergenic
983460942 4:168025340-168025362 CTATCTGGGGCTGGTGGCATGGG - Intergenic
984144421 4:176044039-176044061 TTCTCTGTGGCCGTAGGCAAGGG + Intergenic
984707092 4:182855532-182855554 CTCTCTGGGGCAGCAGGCAGAGG + Intergenic
985020511 4:185684062-185684084 ATTTCAGGGTCTGGAGGCACTGG + Intronic
985317975 4:188678697-188678719 CTCTCAGGGACTGGGGGCAAGGG + Intergenic
986103573 5:4637504-4637526 TGCTCTGGGGCAGGAGGCAGAGG - Intergenic
986614783 5:9604980-9605002 ATCTCTGGGTCTGAAGCCAAAGG - Intergenic
988830082 5:34978539-34978561 ATTGCTGGGGCTGGGGGCAGAGG + Intergenic
992493275 5:77266812-77266834 TTCTTTGGGGCTGAAGGCAGGGG - Intronic
993049329 5:82908500-82908522 ATCTTTGGGGCTGGGTGCAGTGG + Intergenic
993795242 5:92258699-92258721 CTGTCGGGGGCTGGAGGCAAGGG - Intergenic
996101811 5:119452337-119452359 ATTTCTGCGGCTGGAAGCAATGG - Intergenic
996621300 5:125506937-125506959 CTGTCTGGGGGTGGAGGGAAAGG - Intergenic
996648621 5:125846135-125846157 CTCTCAGTGGCTGAAGGCAATGG - Intergenic
997203393 5:132026519-132026541 ACCTCTGTGGCTGCAGGCATGGG + Intergenic
997425363 5:133799226-133799248 ATCTCTGGGCCTGGTGCCCACGG - Intergenic
997455167 5:134011466-134011488 ATCTTCAGGGCTGGAGGGAAGGG - Intergenic
998877768 5:146618031-146618053 ATATTTGGGGATGGGGGCAATGG - Intronic
999472067 5:151863926-151863948 TTCTATGGGGCTGGAGGGAGAGG - Intronic
999506822 5:152207113-152207135 ATTTCTGAGGCAAGAGGCAATGG + Intergenic
999598862 5:153237805-153237827 AACTCTGGGGCTGGAGAGAAAGG - Intergenic
1000447758 5:161345038-161345060 CTGTCTGGGGCTGGGGGCTAGGG + Intronic
1001957152 5:175855794-175855816 ATCTCTAGAGCTTGAGGGAAAGG + Intronic
1002049593 5:176562562-176562584 TGCTCTGGGGCAGGAGGGAAAGG + Intronic
1002185541 5:177453200-177453222 AACTCTGGGGCTGGAGGTGATGG - Intronic
1002659136 5:180778597-180778619 TTCTCTGAGGCTGGGTGCAATGG + Intergenic
1006024360 6:31138009-31138031 ACCTCAGGGGCAGGAGGCCAGGG + Exonic
1006338947 6:33435414-33435436 ACTTCTGGGACTGGAGGAAAGGG + Intronic
1011301492 6:85879017-85879039 AACTCAGGGGCTGGTGGCACAGG + Intergenic
1013151100 6:107447387-107447409 CTCTCTGGGGCTACAGGCACTGG + Intronic
1014083072 6:117310539-117310561 CTGTCTGGGGTTGGGGGCAAGGG - Intronic
1015040854 6:128717149-128717171 ATTTGTGGGGCTGGATGCTATGG + Intergenic
1015509400 6:134023061-134023083 ATATCTGGGGGTTGGGGCAAAGG - Intronic
1016099129 6:140075723-140075745 ATCTCTGGGGGTAGGGGCCAAGG - Intergenic
1016394238 6:143605361-143605383 ATCTCTGGGGCCATAGGAAAGGG + Intronic
1016929452 6:149389239-149389261 ATTTCTGGGGCTGGGTGCAGTGG - Intronic
1016985993 6:149896324-149896346 ATCTCTGGGGCTGGGGGATAAGG + Intronic
1017189603 6:151638203-151638225 TTTTCAGGGGCTGGAGGCAAAGG + Intergenic
1018394768 6:163369856-163369878 ACCTCGCAGGCTGGAGGCAATGG - Intergenic
1018632797 6:165835184-165835206 GTCTCTGGGGCTGGAGGTATGGG - Intronic
1018665048 6:166127731-166127753 ATCCCTGTGGCTGGAGTCACCGG + Intergenic
1019276263 7:177585-177607 AGCTCTGGGGCTGGAAGCCTTGG - Intergenic
1019276368 7:178047-178069 AGCTCTGGGGCTGGAAGCCTTGG - Intergenic
1019276385 7:178124-178146 AGCTCTGGGGCTGGAAGCCTTGG - Intergenic
1020025545 7:4897518-4897540 TTCTCTGGGGTGGGAGGAAACGG - Intergenic
1020212073 7:6165071-6165093 GCCTCTGGGGCTGGTGGGAAAGG - Intronic
1020777557 7:12473655-12473677 ATTTCTGGGGCTGGGTGCAGTGG - Intergenic
1021173695 7:17425307-17425329 TTCCCAGGGGCTGGAGGAAAGGG - Intergenic
1021507868 7:21405211-21405233 ATCTCAGGGTCTGGAGGGCAGGG + Intergenic
1021925032 7:25526046-25526068 AGAACTGGGGCTGGAGGGAAAGG + Intergenic
1022317403 7:29258069-29258091 ATCTGAGGGGCTGGGCGCAATGG - Intronic
1022818661 7:33937562-33937584 GTATCTGGGGCTGGAAGGAAGGG + Intronic
1024682471 7:51707398-51707420 CTGTCAGGGGCTGGAGGGAAAGG - Intergenic
1025095602 7:56093177-56093199 TTCTCTGGGCCTGGAGGCCAAGG - Intergenic
1026286277 7:68965860-68965882 ATCTCTCAGGCTGGAGGGGAAGG + Intergenic
1026851438 7:73726000-73726022 ACCTCTGGGGCTGGTAGGAAAGG + Intergenic
1027363609 7:77434250-77434272 GACTTTGGGGCTGGAAGCAATGG - Intergenic
1027725760 7:81803984-81804006 ATCTCTGGGCCTTGAAGTAAAGG + Intergenic
1028600236 7:92592847-92592869 TACACTGGGCCTGGAGGCAAAGG + Intergenic
1030090535 7:105854051-105854073 GGCTCTGGGGGTGGAGGGAACGG - Intronic
1030203148 7:106926077-106926099 TTCTCTGGGGCTAGGGGCAGTGG + Intergenic
1031763140 7:125739431-125739453 TTCTCTGGGGCTCAAGGCCAGGG - Intergenic
1032085548 7:128881591-128881613 CTCTCTGAGGGTGGAGGCCAAGG + Intronic
1033430332 7:141283281-141283303 ATTCCTGGGGCCAGAGGCAAAGG - Intronic
1034040399 7:147871351-147871373 ATATCTGGGGCAGGGGGCCATGG - Intronic
1034042977 7:147898803-147898825 ATCTCTGGGGCTGGACGTGGTGG - Intronic
1035270806 7:157718944-157718966 ATGTGTGGGGATGGAGGCAAGGG - Intronic
1035925785 8:3726198-3726220 CTGGCTGGGGCTGCAGGCAACGG - Intronic
1036648724 8:10628475-10628497 ATCTCTGGGGCTGGGGGTGGAGG - Intronic
1036739252 8:11346892-11346914 ATCTCCGGGGCTGGGGGGGACGG - Intergenic
1036919796 8:12841283-12841305 ATCTCTGGGACAGAAAGCAAGGG - Intergenic
1037410408 8:18589793-18589815 AACTCTGGAGCTGAAAGCAAAGG + Intronic
1037686197 8:21141592-21141614 ATCTCTGGGGCAGGTGCCATTGG + Intergenic
1038782016 8:30576030-30576052 AACGCTGGGGCTGGAAGGAACGG + Intergenic
1038811430 8:30849894-30849916 ATCTCGGGGGCTGGGGGCAGAGG + Intronic
1039429823 8:37517090-37517112 TTCTCTGGGGGTGGTGGCAGGGG - Intergenic
1041188789 8:55331123-55331145 ACACCAGGGGCTGGAGGCAATGG - Intronic
1041786358 8:61638745-61638767 TTCTCAGGGGCTGGCGGCAGAGG - Intronic
1042092700 8:65176356-65176378 ATCTTTGGGGCCAGGGGCAATGG + Intergenic
1043479545 8:80639014-80639036 ATATCTGGGGGTGGAAGCCACGG + Exonic
1043873490 8:85461137-85461159 ATATCTGGGGCTGGACTCAGTGG - Intergenic
1044614591 8:94126843-94126865 ATCTCCCAGGCTGGAGGCACTGG + Intergenic
1045364520 8:101463179-101463201 ACCACTGGAGCTGGAGGAAAGGG - Intergenic
1046056711 8:109086911-109086933 ATCTGTGGGGCAGGGGGCATGGG + Intronic
1046931746 8:119848248-119848270 ATTTTTGGGGTTGGGGGCAATGG - Intronic
1047372667 8:124268924-124268946 AGCACTGGAGCAGGAGGCAAGGG + Intergenic
1048141316 8:131797411-131797433 ATCTCTGGAGCCAGAGGCAGAGG - Intergenic
1048193058 8:132307997-132308019 GTTTCTGGGACAGGAGGCAAGGG - Intronic
1048713246 8:137235373-137235395 AAGGGTGGGGCTGGAGGCAAAGG - Intergenic
1048859231 8:138711654-138711676 TTCTCTGGGGCTGGAGGCTGAGG - Intronic
1049051481 8:140200375-140200397 CACTCTAGGGCTGGAGGCAGGGG - Intronic
1049143693 8:140981399-140981421 ACCTGTGGGGCAGGAGGGAAGGG + Intronic
1049170973 8:141160465-141160487 ATCACTGGGGCTGGACGCGGTGG - Intronic
1049850746 8:144828935-144828957 AAATCTGGGGCTGGAGGTAAAGG + Intronic
1049934013 9:483337-483359 ATCTCTGGGGATTGAAGCTAAGG - Intronic
1049979233 9:888837-888859 ATCTCCTGGGCTGGATGCAGTGG + Intronic
1049990581 9:987212-987234 TTGTCAGGGGCTGGAGGAAAAGG - Intronic
1050913490 9:11103007-11103029 CTCTATGGGGCTGGACGCAGTGG + Intergenic
1053176297 9:35927225-35927247 ATCAGTGTGGCTGGAGGGAAGGG + Intergenic
1053314806 9:37042182-37042204 CTCTCTGGGGCTGGGGCCCAGGG - Intergenic
1053350000 9:37407528-37407550 ATCTCTGGGGTAAGATGCAATGG - Intergenic
1054904561 9:70403323-70403345 ATCTCTGGGTCTGGAGGTGTGGG - Intronic
1055220973 9:73931231-73931253 TTACCAGGGGCTGGAGGCAAGGG + Intergenic
1056992227 9:91423219-91423241 TTCTCTGGGGCTGGCGGCGTAGG - Intronic
1057198156 9:93126612-93126634 CCCGCTGGGGCTGGAGGCACGGG - Exonic
1057432651 9:95008199-95008221 CCCTTCGGGGCTGGAGGCAAGGG - Intronic
1059143013 9:111871801-111871823 CTATCTGGGGCTGGTGGCACAGG - Intergenic
1059497940 9:114725413-114725435 ATCTCTGGGGAAGGAGAAAAGGG + Intergenic
1060217267 9:121745893-121745915 ACCACTGGGGCTGGAGTCTAGGG + Intronic
1060231318 9:121827457-121827479 AGCTCTGGGACTGGAGCCCAGGG + Intronic
1060278254 9:122198398-122198420 ATCTCTTAGGCAGGAGGCACTGG + Intronic
1060727557 9:126016403-126016425 GTCTTTGGGGCTGGAGGAGACGG + Intergenic
1060932963 9:127500460-127500482 CTCTGTGGGGCTGGGGGCAGGGG + Intronic
1060996111 9:127875632-127875654 ATGTCTGGGGCTGGAGAGAAAGG - Intronic
1062475019 9:136722473-136722495 CTCTCCAGGGCTGGGGGCAAGGG + Intronic
1185445922 X:258051-258073 AGCTCTGGGGGTGGATGCAGGGG - Intergenic
1185779264 X:2830337-2830359 CTCTCTGGGGCTGGAGGGAATGG + Intronic
1186516314 X:10168309-10168331 TTCCCTGGTGCTGGAGGAAAAGG - Intronic
1187279578 X:17847643-17847665 ACTTCTGTGGCTGGGGGCAAAGG - Intronic
1189711858 X:43821359-43821381 CTCTCTGGGGCTGGAGTTCAGGG - Intronic
1191115195 X:56844979-56845001 TTCTCTGTGGCTGGAGAGAATGG - Intergenic
1192156819 X:68753079-68753101 ATCTCAGGGACTGGACACAAGGG + Intergenic
1194125589 X:90012552-90012574 ATCACAGGGGCTGGAGGCTTAGG + Intergenic
1195216315 X:102707192-102707214 ATGGCTGGGACTGTAGGCAAAGG + Intergenic
1196462528 X:115945052-115945074 CTTTCTGGGGCTGGACTCAAAGG + Intergenic
1197869514 X:131051684-131051706 ATCACGGGGGCTGGTGGGAAGGG - Intergenic
1199774245 X:150996926-150996948 ATCTCTGGGCCTGGAGCTCAAGG - Intergenic
1200258714 X:154600087-154600109 CCCTCTGGGGGTGGAGGCAGAGG + Intergenic
1201290783 Y:12420152-12420174 CTCTCTGGGGCTGGAGGGAATGG - Intergenic