ID: 1175198954

View in Genome Browser
Species Human (GRCh38)
Location 20:57265441-57265463
Sequence GGCCGGCGGCGTAACATGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175198941_1175198954 17 Left 1175198941 20:57265401-57265423 CCGCGCTTTGAACGGCCCTTGCC 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198947_1175198954 -7 Left 1175198947 20:57265425-57265447 CCAGCCCCAGAGATGCGGCCGGC 0: 1
1: 0
2: 1
3: 17
4: 142
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198942_1175198954 2 Left 1175198942 20:57265416-57265438 CCCTTGCCTCCAGCCCCAGAGAT 0: 1
1: 0
2: 2
3: 46
4: 435
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198939_1175198954 19 Left 1175198939 20:57265399-57265421 CCCCGCGCTTTGAACGGCCCTTG 0: 1
1: 0
2: 1
3: 4
4: 23
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198938_1175198954 24 Left 1175198938 20:57265394-57265416 CCGAGCCCCGCGCTTTGAACGGC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198945_1175198954 -4 Left 1175198945 20:57265422-57265444 CCTCCAGCCCCAGAGATGCGGCC 0: 1
1: 0
2: 3
3: 35
4: 329
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198943_1175198954 1 Left 1175198943 20:57265417-57265439 CCTTGCCTCCAGCCCCAGAGATG 0: 1
1: 0
2: 7
3: 71
4: 550
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32
1175198940_1175198954 18 Left 1175198940 20:57265400-57265422 CCCGCGCTTTGAACGGCCCTTGC 0: 1
1: 0
2: 0
3: 4
4: 62
Right 1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175198954 Original CRISPR GGCCGGCGGCGTAACATGGA GGG Intronic
906196371 1:43933012-43933034 GGCTGGGTGAGTAACATGGATGG - Intergenic
919820510 1:201469165-201469187 GGCGAGCGGCGGAACATGTAAGG - Exonic
924953399 1:248906181-248906203 GCCCGGGGGCGTGGCATGGAAGG + Intronic
1075821627 10:125318013-125318035 GGCCAGCAGAGAAACATGGATGG - Intergenic
1078463495 11:11533084-11533106 GGGCTGGGGAGTAACATGGATGG - Intronic
1092761861 12:11818035-11818057 GGCCTGCGGGGTGACAGGGAGGG + Intronic
1100830899 12:98515932-98515954 GGCCGGCAGCGTCACATTGTTGG - Exonic
1104444735 12:128823936-128823958 AGCTGGCGGCGTCGCATGGAGGG - Exonic
1104689330 12:130813595-130813617 GGCCGGCCTCCTAACACGGAGGG + Intronic
1113960232 13:114122116-114122138 GGCCGGCTGCGCAGCCTGGAAGG - Intronic
1121658979 14:95620600-95620622 GGCCAGCTGCCTAACCTGGATGG + Intergenic
1128687212 15:69695659-69695681 GGCCGTCGGGGCAACCTGGATGG - Intergenic
1135959551 16:26984394-26984416 AGCAGGCAGAGTAACATGGAAGG - Intergenic
937221775 2:120346174-120346196 CGCCAGCGGCGCACCATGGACGG + Exonic
937347224 2:121133523-121133545 GGCCCTGGGCGTAACATTGAAGG + Intergenic
1175198954 20:57265441-57265463 GGCCGGCGGCGTAACATGGAGGG + Intronic
1175540179 20:59743411-59743433 GGCCAGCGGGGTAACTTGCATGG - Intronic
1180592283 22:16950856-16950878 AGCAGGCGGAGGAACATGGAAGG - Intergenic
1185366311 22:50438540-50438562 GGACGGACGCCTAACATGGAGGG - Intronic
961144795 3:124584807-124584829 GGGCGGCGGGGCAACATGAAGGG + Intronic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
974839808 4:67286976-67286998 GGCCGGCTGCTTAACATGCAGGG + Intergenic
1026360491 7:69598217-69598239 GGCCGGCGGGATCACGTGGACGG - Intergenic
1031620198 7:123926258-123926280 GGCCGGCGGGGAAAGAAGGAGGG - Intronic
1033732805 7:144195574-144195596 GGCCGGCGCCGGGACCTGGAGGG - Exonic
1033743656 7:144294154-144294176 GGCCGGCGCCGGGACCTGGAGGG - Intergenic
1033750246 7:144355443-144355465 GGCCGGCGCCGGGACCTGGAGGG + Exonic
1051181831 9:14419591-14419613 GGCCAGCTACGTAACATGCAAGG - Intergenic
1052888832 9:33677000-33677022 CGGCGGCGGCGGCACATGGAGGG - Intergenic
1056399041 9:86209238-86209260 GGCAGGGGGCTTACCATGGAGGG - Intergenic
1057298068 9:93860905-93860927 GGGAGGCGGCGTGACACGGAGGG + Intergenic
1062454200 9:136628027-136628049 GGGCTGCGGCGCCACATGGATGG + Intergenic
1062689711 9:137834944-137834966 GGCCGGCGGCGTCTCATAGGGGG - Exonic
1188228548 X:27632125-27632147 CTCCGGCAGCGCAACATGGAGGG - Intronic