ID: 1175199301

View in Genome Browser
Species Human (GRCh38)
Location 20:57266745-57266767
Sequence GAACCCACTGGGCACAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 269}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175199301_1175199309 26 Left 1175199301 20:57266745-57266767 CCCCAGCTGTGCCCAGTGGGTTC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1175199309 20:57266794-57266816 AATGTTTACTGAGTGCCCACGGG 0: 1
1: 2
2: 9
3: 51
4: 325
1175199301_1175199308 25 Left 1175199301 20:57266745-57266767 CCCCAGCTGTGCCCAGTGGGTTC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1175199308 20:57266793-57266815 AAATGTTTACTGAGTGCCCACGG 0: 1
1: 0
2: 6
3: 37
4: 312
1175199301_1175199310 27 Left 1175199301 20:57266745-57266767 CCCCAGCTGTGCCCAGTGGGTTC 0: 1
1: 0
2: 2
3: 19
4: 269
Right 1175199310 20:57266795-57266817 ATGTTTACTGAGTGCCCACGGGG 0: 1
1: 0
2: 5
3: 37
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175199301 Original CRISPR GAACCCACTGGGCACAGCTG GGG (reversed) Intergenic
900001875 1:18969-18991 GAATGCACTTGGCACATCTGGGG - Intergenic
900021595 1:189492-189514 GAATGCACTTGGCACATCTGGGG - Intergenic
900556904 1:3285157-3285179 GAGCCCACTGGGCAAACCTAGGG + Intronic
902083424 1:13837393-13837415 TAAGCCACTGCGCCCAGCTGGGG + Intergenic
902259331 1:15212732-15212754 GATCCCACTGCAGACAGCTGCGG - Intronic
902560926 1:17277034-17277056 GACACCACTGCCCACAGCTGGGG + Intronic
902610521 1:17594559-17594581 GAACCCAGGGGGCAGAGCAGAGG - Intronic
903259181 1:22122075-22122097 GAGCCCAGTGGGGCCAGCTGGGG - Intronic
906153322 1:43600274-43600296 AACCCCACTGGCCACAGCTGTGG - Intronic
906300825 1:44680455-44680477 TAAGCCACTGCGCCCAGCTGGGG + Intronic
908888333 1:68815522-68815544 GAAGATACTGGGGACAGCTGTGG - Intergenic
909717098 1:78722362-78722384 GAACCCAGTGGGAAGAGCTATGG + Intergenic
910935489 1:92482837-92482859 GAACCCACTGGGAACCTCTTGGG - Intronic
914754841 1:150556838-150556860 GTTCCCTCTGGGCAGAGCTGTGG + Intronic
917689687 1:177455974-177455996 TAAGCCACTGGGAACAGCAGAGG - Intergenic
919051121 1:192512606-192512628 GAAACCACTTCCCACAGCTGGGG + Intergenic
919364431 1:196639285-196639307 TAAGCCACTGTGCCCAGCTGAGG - Intergenic
920926267 1:210344420-210344442 TCACCTAATGGGCACAGCTGTGG - Intronic
921261192 1:213386388-213386410 CAACCCACTTTGCACAGATGAGG - Intergenic
922696145 1:227731986-227732008 GAACCCACAGGGCAGAGCCAGGG + Exonic
923771329 1:236940236-236940258 GAAGACAGTGGGCAAAGCTGTGG - Intergenic
924317275 1:242811279-242811301 GAACCTAAAGGGCACAGCTTTGG + Intergenic
924558749 1:245140071-245140093 AAACCCACTGTGCAGAGCTAAGG - Intergenic
1063607358 10:7534429-7534451 GAAGCTTCTGGGAACAGCTGTGG - Intergenic
1065938244 10:30540702-30540724 CATCCCACTGGGCTCAGCTGAGG - Intergenic
1067742361 10:48905295-48905317 TAACTTAGTGGGCACAGCTGGGG - Intronic
1067939653 10:50643535-50643557 GAACCTAATGGGCACATCTTTGG - Intergenic
1068519745 10:58065114-58065136 GGAACCTGTGGGCACAGCTGAGG - Intergenic
1069076380 10:64042094-64042116 GCACCCACAGTGCACGGCTGGGG + Intergenic
1069297228 10:66861373-66861395 GAACCGAATGTGCACAGCTTTGG - Intronic
1069789532 10:71010796-71010818 GAAGCCACTGAGCCCAGCCGGGG - Intergenic
1070580455 10:77715107-77715129 GATCCCACTGAGTACAGTTGTGG - Intergenic
1070892652 10:79953035-79953057 GAACCCACAGGAAAAAGCTGTGG - Intronic
1071255346 10:83867349-83867371 GAATCCACTGGGTACAGCACAGG + Intergenic
1073327574 10:102651372-102651394 GACCCCTCAGGGCACAGCAGAGG - Intronic
1074177471 10:111023575-111023597 TAGTACACTGGGCACAGCTGAGG + Intergenic
1074578548 10:114694238-114694260 GAACCCACACAGCTCAGCTGTGG - Intergenic
1075008305 10:118846259-118846281 GAATCCACAGGGGCCAGCTGGGG - Intergenic
1076360371 10:129884153-129884175 GAAAGCAGTGGCCACAGCTGTGG + Intronic
1076525267 10:131108724-131108746 GATCCCACTGGGCTGAGATGAGG + Intronic
1076804916 10:132850511-132850533 CCACCCACAGGGCACAGCAGAGG - Intronic
1077319756 11:1935923-1935945 GGACCCCCTGGGGACAGCTCTGG - Intronic
1077374599 11:2199623-2199645 GAACCCCCAGGCCACAGCTGGGG + Intergenic
1081749767 11:45501681-45501703 GAAGCCATCGGGCAGAGCTGGGG - Intergenic
1083263858 11:61537259-61537281 GCATCCACTGGCCCCAGCTGTGG + Intronic
1083440210 11:62671363-62671385 GAAACCACAGAGCACAGCTCGGG + Exonic
1083466826 11:62852952-62852974 GAACCCACTGGGACTGGCTGGGG - Intergenic
1084375063 11:68771061-68771083 GAACCCACGTGGCCCAGGTGTGG - Intronic
1084981311 11:72830173-72830195 GAGCCCACAGGGCAGAGTTGGGG + Intronic
1085201956 11:74707214-74707236 GAAATCACAGGGCACAACTGAGG + Intronic
1085458394 11:76678625-76678647 GAGCTAACTGGGCACAGCTAGGG - Intergenic
1091374955 12:19074-19096 GAATGCACTTGGCACATCTGGGG - Intergenic
1091808453 12:3374969-3374991 GAACCAACTGGGCAGATGTGTGG - Intergenic
1093216721 12:16370334-16370356 GAACAGACTGGGCACAGTTTGGG - Intronic
1093914631 12:24787856-24787878 GAAAAGACTGAGCACAGCTGGGG + Intergenic
1095401224 12:41816643-41816665 GAACCTAATGTGCACAGCTTTGG + Intergenic
1095710227 12:45280314-45280336 TAACCCAGTGTGCTCAGCTGTGG + Intronic
1096792109 12:54051808-54051830 GCACCCTTTGGGCACGGCTGTGG + Intronic
1097010123 12:55947266-55947288 TAAGCCACTGCGCCCAGCTGTGG + Intronic
1100490700 12:95075113-95075135 GAAGCCACTGTGCTCAGCAGAGG - Intergenic
1101383689 12:104236708-104236730 GAACCCAGGAGGCAGAGCTGTGG + Intronic
1101984351 12:109433900-109433922 GCAGCCACTGGGGACAGCAGTGG - Intronic
1101996218 12:109527031-109527053 GAACCCAGAGGGCACAGAGGTGG + Intronic
1102085834 12:110138714-110138736 TAAGCCACTGGGCCCGGCTGAGG + Intronic
1104080334 12:125424802-125424824 GAACACAGTGGAGACAGCTGGGG + Intronic
1104589641 12:130074130-130074152 GAGCCCTATGGGCACTGCTGAGG + Intergenic
1104626901 12:130364315-130364337 AAAGCCACTGGCCACATCTGGGG + Intronic
1105603150 13:21905165-21905187 GAACCTAATGTGCACAGCTTTGG + Intergenic
1106144282 13:27037754-27037776 GACCCAGCTGTGCACAGCTGTGG - Intergenic
1107758181 13:43648479-43648501 GAACACAGAGGGCAGAGCTGGGG + Intronic
1111296581 13:86287105-86287127 GAACCTAATGTGCACAGCTTTGG + Intergenic
1112433010 13:99368982-99369004 GATCCCACTGGCCACATCTAGGG + Intronic
1113886857 13:113665631-113665653 GGACACACTGGAGACAGCTGGGG - Intergenic
1114202944 14:20540009-20540031 GAACCCCTGGGGCACAGCTTGGG - Intergenic
1117901086 14:60534033-60534055 GAACCCACAGAACAGAGCTGAGG - Intergenic
1118643590 14:67816599-67816621 GAACCCACTCCGAACAGCGGTGG + Intergenic
1119473914 14:74916166-74916188 GATCTGTCTGGGCACAGCTGTGG + Intronic
1121096163 14:91219545-91219567 CAACTCACTGAGCAGAGCTGTGG - Intronic
1121338732 14:93092679-93092701 GATGCCGTTGGGCACAGCTGTGG + Intronic
1121728426 14:96169745-96169767 GAACCCACTGCCCACAGATTGGG - Intergenic
1122355672 14:101121651-101121673 GAACACAGTGGGGACACCTGGGG - Intergenic
1124025881 15:25964978-25965000 GCCCACACTGGGGACAGCTGTGG + Intergenic
1124371223 15:29105923-29105945 GAAGCCACTGGGACCAGCTAAGG - Intronic
1124604891 15:31162609-31162631 GAGCCCACTGGGCAGGGATGTGG + Intergenic
1124620694 15:31272335-31272357 GAACCCACTGGGCTGTGCGGTGG + Intergenic
1128550462 15:68595171-68595193 GACCCCACAAGTCACAGCTGAGG - Intronic
1128716475 15:69912280-69912302 GGACCCACTGGACACAGTAGCGG - Intergenic
1129158933 15:73736297-73736319 GAAGCCACTGGGGCCAGGTGCGG + Exonic
1129658010 15:77537470-77537492 GAAGACCGTGGGCACAGCTGAGG + Intergenic
1129697573 15:77749348-77749370 GTACTCACTGGGCCCACCTGGGG - Intronic
1132451634 15:101971971-101971993 GAATGCACTTGGCACATCTGGGG + Intergenic
1132455255 16:18658-18680 GAATGCACTTGGCACATCTGGGG - Exonic
1132468658 16:89687-89709 GGACCCCCAGGGCACCGCTGTGG - Intronic
1132541982 16:514422-514444 GAACCTCCTGGGAACAGCAGGGG + Intronic
1132614082 16:831780-831802 GCACCCGCTGGTCAGAGCTGGGG - Intergenic
1132723418 16:1327903-1327925 GAAGCCATTGGGCCCAGTTGGGG + Intergenic
1133301214 16:4783925-4783947 CCACCCACTGGGCACTGGTGAGG - Exonic
1135419171 16:22293324-22293346 GAACCCACTAGCCATGGCTGTGG + Intergenic
1136542348 16:30935131-30935153 CAACCCCCAGAGCACAGCTGAGG - Intronic
1137729443 16:50679249-50679271 GCACCCCCTGAGCACAGATGGGG + Intronic
1138201113 16:55089188-55089210 GGATCCACTGGGCACAGGAGAGG + Intergenic
1139240990 16:65392328-65392350 GACCCCACTTGGCACAGCTTGGG + Intergenic
1139340951 16:66267527-66267549 GCTCCCACTGTGCACAGGTGGGG + Intergenic
1139972236 16:70783381-70783403 GAAGCACATGGGCACAGCTGGGG + Intronic
1141431796 16:83974036-83974058 CCACCCCCTGAGCACAGCTGTGG + Intronic
1141666905 16:85470352-85470374 CACACCACTGGGCAGAGCTGGGG + Intergenic
1141725614 16:85786543-85786565 CAAACAACTGGGCACAGCGGGGG + Intronic
1142176551 16:88647990-88648012 GAACGCCCAGGGCAGAGCTGGGG - Intronic
1142355720 16:89600858-89600880 GAACCCATTGGTCTCACCTGGGG - Intergenic
1142713947 17:1737973-1737995 GGACCCAGAGGGCAGAGCTGGGG - Exonic
1142786994 17:2232123-2232145 GAACAAATTGGGCACAGATGGGG + Intronic
1143108716 17:4541969-4541991 GGGCCCGCTGGGCACTGCTGTGG + Intronic
1143512370 17:7403843-7403865 GAACCAATTGGACCCAGCTGGGG + Intronic
1144208227 17:12994070-12994092 GAAACCACAGGGCCCACCTGGGG + Intronic
1144688862 17:17245784-17245806 TAAGCCACTGCACACAGCTGAGG + Intergenic
1144887959 17:18476879-18476901 GAACTCACTGGGCTCAGATAGGG - Exonic
1145144248 17:20467424-20467446 GAACTCACTGGGCTCAGATAGGG + Exonic
1145175699 17:20698824-20698846 GAACTCACTGGGCTCAGATAGGG + Intergenic
1149773871 17:59342213-59342235 GGTCCCCCAGGGCACAGCTGGGG - Intronic
1151493141 17:74444337-74444359 GGGCCCCCTTGGCACAGCTGTGG - Intronic
1152386093 17:79975682-79975704 CAACCAACTGTGCACAGCTTCGG + Intronic
1152430587 17:80246407-80246429 GAGCCCACTGGGGACAGGGGTGG - Intronic
1153437038 18:5078677-5078699 GAACCCACTCGGAACAGTTAGGG - Intergenic
1153733715 18:8043024-8043046 GAGCCCAGTGTGCCCAGCTGTGG - Intronic
1157851104 18:51051735-51051757 GAAACCACTGGGCCCACCTTAGG - Intronic
1159466720 18:68793107-68793129 GAACTCACAGAGTACAGCTGTGG - Intronic
1159714990 18:71810619-71810641 TGTCCCACTGGGCAAAGCTGTGG - Intergenic
1160327935 18:77967885-77967907 GGACTCACTGGGCTCAGCTAAGG - Intergenic
1160633627 19:60577-60599 GAATGCACTTGGCACATCTGGGG - Intergenic
1160874062 19:1289141-1289163 GAATCCACAGGGCACAGCTCTGG + Intronic
1161659924 19:5539729-5539751 ACACTCACTGGGCACGGCTGTGG + Intergenic
1163307244 19:16488365-16488387 TAAGCCACTGTGCCCAGCTGAGG + Intronic
1163324130 19:16592314-16592336 GAGCCCACCAGGCACAGCTGTGG + Intronic
1167253589 19:48414575-48414597 GAACCCACAGGTGACAGCTCGGG + Exonic
1167561513 19:50228794-50228816 GCCCCTCCTGGGCACAGCTGTGG + Intronic
1168098560 19:54128907-54128929 GTACCCACTCGGCCCGGCTGAGG - Intronic
925025575 2:604457-604479 GGGCCCACTGAGCACAGCGGGGG + Intergenic
925060142 2:884734-884756 GAACCCACTGTGCCCATGTGAGG + Intergenic
927029576 2:19106369-19106391 GAACTCACAGGGTACAGCTCAGG + Intergenic
927246122 2:20958356-20958378 CAGCCCACAGGGCAGAGCTGCGG + Intergenic
928027963 2:27755129-27755151 GTACCTACTGGGCACTGGTGGGG + Intergenic
929694177 2:44100060-44100082 GAACCCCAGGTGCACAGCTGTGG - Intergenic
930736698 2:54787057-54787079 GACCTCAGTGGGCACACCTGAGG - Intronic
934529719 2:95077265-95077287 CAGCCCGCTGGGCAGAGCTGGGG + Intergenic
935696028 2:105771882-105771904 GAAGCTTCTGGGAACAGCTGCGG - Intronic
935698325 2:105789050-105789072 GAACCCTCTGAGCACAAGTGAGG - Intronic
936484762 2:112916432-112916454 GAACCCTCTGAGCACTGTTGTGG + Intronic
936567847 2:113594438-113594460 GAATGCACTTGGCACATCTGGGG + Intergenic
936992429 2:118380370-118380392 GACCCCACTGGGCCAAGCTGAGG + Intergenic
937435639 2:121878762-121878784 CAACAGACTGGACACAGCTGAGG - Intergenic
938081891 2:128374590-128374612 GTACCCACTCGGCACCCCTGTGG + Intergenic
938299863 2:130202595-130202617 GTAGCAACTGGGCACAGCAGGGG - Intergenic
938340581 2:130533452-130533474 GGAGCCATTGGGCAGAGCTGGGG + Intergenic
938349249 2:130587267-130587289 GGAGCCATTGGGCAGAGCTGGGG - Intergenic
938456850 2:131471890-131471912 GTAGCAACTGGGCACAGCAGGGG + Intronic
939097042 2:137844496-137844518 TAACCCACTATGCACAGCTATGG + Intergenic
941257996 2:163257907-163257929 GGAACCACTGCGCCCAGCTGAGG + Intergenic
943569616 2:189558120-189558142 GTACCCACTGTGAACAGCTTAGG - Intergenic
947780004 2:232751154-232751176 AAACTTACTGGGCACAGCTATGG - Intronic
947878923 2:233487936-233487958 GAACACACTGACAACAGCTGCGG + Intronic
948385106 2:237576103-237576125 GATCCCAGAGGGCACAGCTCAGG + Intronic
948558031 2:238830340-238830362 GATCCCAATGGTCAAAGCTGAGG + Intergenic
1169350114 20:4861942-4861964 GAACCCTCTGGTCACAGGTGAGG - Exonic
1171258965 20:23714348-23714370 GAACCCACTTGGAACTGCTCGGG - Intergenic
1172304381 20:33870982-33871004 GAGGCCCCAGGGCACAGCTGGGG + Intergenic
1174049758 20:47759406-47759428 TGAGCCACTGCGCACAGCTGCGG - Intronic
1174072769 20:47910208-47910230 CAACTCGCTGGGCCCAGCTGGGG + Intergenic
1174151301 20:48488467-48488489 CAACTCGCTGGGCCCAGCTGGGG - Intergenic
1174227276 20:49011721-49011743 GAATGCACTGGGTACAGCTTGGG - Intronic
1175199301 20:57266745-57266767 GAACCCACTGGGCACAGCTGGGG - Intergenic
1176028197 20:62996975-62996997 GCTCACAGTGGGCACAGCTGTGG + Intergenic
1176216309 20:63949571-63949593 TGCCCCACTGTGCACAGCTGCGG - Intronic
1179098728 21:38337901-38337923 GTGCCCACTTGGCACAGCAGTGG - Intergenic
1179312170 21:40206278-40206300 GAATCCACTGGAAACTGCTGGGG + Intronic
1180717313 22:17880656-17880678 GTCCTCACTGGCCACAGCTGTGG + Intronic
1181435806 22:22910153-22910175 GCACTCACTGGGGACACCTGAGG + Intergenic
1182008628 22:26982018-26982040 GAACCCACTGAACAAGGCTGAGG + Intergenic
1182357544 22:29729165-29729187 GAGCCACCTGGGCACAGCCGAGG + Exonic
1183626167 22:39003599-39003621 GAACCCACAGGTCTGAGCTGTGG - Intergenic
1183735444 22:39642406-39642428 GAGCCCACCTGGCAGAGCTGGGG - Intronic
1184027650 22:41869766-41869788 GGAGCCACTGTGCCCAGCTGGGG + Intronic
1185199415 22:49492361-49492383 GGGGCCACTGGGTACAGCTGGGG - Intronic
1185242577 22:49754618-49754640 CCTGCCACTGGGCACAGCTGGGG - Intergenic
949126378 3:449941-449963 GAACACACTGAGAACTGCTGGGG - Intergenic
950457275 3:13100181-13100203 CAACTCCCTGTGCACAGCTGAGG - Intergenic
950614945 3:14150820-14150842 GACCCCACAGGGCACAGAGGTGG + Intronic
950626731 3:14252951-14252973 TCACCCACTGGGGTCAGCTGTGG - Intergenic
952541672 3:34373550-34373572 GAATCCAATGGCCAGAGCTGTGG + Intergenic
954611517 3:51946970-51946992 GATCCCAGTGGCTACAGCTGTGG + Intronic
954652367 3:52172918-52172940 GTACCCACTGGACTCACCTGGGG - Intergenic
955218437 3:57004120-57004142 CACCTCACTGGGCACGGCTGGGG - Intronic
960636784 3:119792409-119792431 GAACTCACTGGCCACTGCAGGGG + Intronic
961031937 3:123613712-123613734 GAACCCTCTGGGCTGAGCTGTGG + Exonic
962200833 3:133400050-133400072 AAACCCACTGGGCACCACAGAGG + Exonic
962880650 3:139573476-139573498 CAACCCTCTGGGCACAGATAAGG - Intronic
965534645 3:169812254-169812276 CAAACCTCTGGCCACAGCTGGGG + Intronic
967201394 3:187075489-187075511 GAACCCACTGGGCAGAGCTCTGG + Intronic
967995634 3:195164379-195164401 AGACCAACTGGGGACAGCTGAGG - Intronic
968731627 4:2271844-2271866 GCACTTGCTGGGCACAGCTGGGG + Intronic
969629211 4:8325744-8325766 CAACACACAGGTCACAGCTGTGG - Intergenic
970676532 4:18456685-18456707 GAACCTAATGTGCACAGCTTTGG - Intergenic
970872702 4:20834476-20834498 GAACAAACTGGACACAGCAGGGG + Intronic
972402462 4:38718350-38718372 TAACCCAGTGTGCACAGCTTTGG - Intergenic
973211812 4:47623625-47623647 GAACCCAGTGGACATATCTGTGG - Exonic
973788285 4:54355364-54355386 GAGCCCATTTGGCACAGCTGTGG + Intergenic
975321204 4:73011648-73011670 GAACTCCCTGGGTGCAGCTGTGG + Intergenic
980807851 4:137837087-137837109 GAACTCACTGGAAACAACTGAGG + Intergenic
982146715 4:152402979-152403001 AAAGCCACTGGGCACAGGTTTGG + Intronic
984432256 4:179664373-179664395 GAACTTAATGGGCACAGCTTTGG + Intergenic
985272403 4:188206737-188206759 GAACCCAATGAGCACAGCTTTGG - Intergenic
985536919 5:470309-470331 GAAGCCACTGGACACAGCTGTGG - Intronic
985723838 5:1505459-1505481 CCACCCACTGGGAACAGCTCCGG + Intronic
986786879 5:11122935-11122957 GACCCCTCAGGGCAGAGCTGAGG + Intronic
991359419 5:65803667-65803689 TACCCTCCTGGGCACAGCTGCGG - Intronic
994617686 5:102127002-102127024 TAATACACTGGACACAGCTGAGG - Intergenic
997081191 5:130740259-130740281 GAACCAGCTGGTCAGAGCTGTGG - Intergenic
997415771 5:133727457-133727479 CTTCCCACTGGGCACACCTGGGG + Intergenic
998138815 5:139688580-139688602 GGACTCTCGGGGCACAGCTGAGG + Intergenic
998457835 5:142287451-142287473 AAGCCCCCAGGGCACAGCTGGGG - Intergenic
999859835 5:155633533-155633555 GAGCTCCCTGGGTACAGCTGTGG + Intergenic
1000982190 5:167827875-167827897 GATCCTACAGGGCACAGCAGGGG - Intronic
1001185761 5:169570185-169570207 GAACCAACTGGGAGCAGCTTGGG + Intergenic
1001679187 5:173543831-173543853 GAACCGCCGGGGCACAGGTGTGG - Intergenic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1002594222 5:180311930-180311952 GAAAGCACTGAGCACTGCTGAGG + Intronic
1002668478 5:180845675-180845697 GAACTCCTTGGGTACAGCTGTGG + Intergenic
1004027333 6:11831820-11831842 GAACGCACTGGCCCCAGCTCTGG - Intergenic
1004335738 6:14762805-14762827 GAAGCCTCTGGGCACTGCAGAGG - Intergenic
1009567920 6:65336807-65336829 GAATCCACTGGGCATATCTGTGG - Intronic
1009941148 6:70289309-70289331 CAACACTATGGGCACAGCTGAGG + Intronic
1015786410 6:136923739-136923761 GAATCCGGTGGGCAGAGCTGGGG + Intronic
1015986740 6:138892221-138892243 TAATACACTGGACACAGCTGAGG - Intronic
1016945302 6:149526692-149526714 GAACCCAGTGACCACAGATGAGG - Exonic
1018646976 6:165957966-165957988 AAACCCACTGCCCACTGCTGGGG - Intronic
1018924786 6:168198515-168198537 GAGGCCACTGGGCAGGGCTGAGG - Intergenic
1019310220 7:356880-356902 AAAGCCCCTGGGCACAGATGAGG - Intergenic
1019707601 7:2503938-2503960 CAACCCCTAGGGCACAGCTGTGG + Intergenic
1020568116 7:9822797-9822819 GAGCTCCCTGGGCACAGCTGTGG - Intergenic
1021689856 7:23221324-23221346 GAACCCAAGGGACACTGCTGTGG + Intergenic
1022333940 7:29405477-29405499 GGTCCCAGAGGGCACAGCTGAGG - Intronic
1023162589 7:37311690-37311712 GCTGTCACTGGGCACAGCTGTGG - Intronic
1024042363 7:45565317-45565339 GGACACACTGTGCACAGTTGCGG - Intergenic
1024510412 7:50199612-50199634 GAAGCCACTGGGCATGGATGGGG + Intergenic
1026110316 7:67454243-67454265 GAACCCAGTGACCACAGCTGAGG + Intergenic
1028617283 7:92782692-92782714 AAACACACTGGGCCCAGGTGTGG - Intronic
1029297316 7:99551683-99551705 AAAACCAGTGGGCACAACTGGGG + Intronic
1029605836 7:101598935-101598957 CCACACACTGGGCCCAGCTGGGG + Intergenic
1033583066 7:142753972-142753994 GAACCCACTGGATGCAGCAGAGG + Intronic
1033586090 7:142775444-142775466 GCACCCACTGGACACAGCAGAGG + Intergenic
1033599947 7:142882153-142882175 GTACCCTCTGGGCAGGGCTGGGG + Intronic
1034343396 7:150371790-150371812 GGTCCCACTGGGCAAAGCTCCGG - Exonic
1036794352 8:11744456-11744478 GAAGCCAGGGGGCACAGCTGTGG - Intronic
1037714514 8:21385801-21385823 GAACTCATTGAGAACAGCTGGGG - Intergenic
1038151990 8:24950308-24950330 GAACCGGCTGGGCAAGGCTGAGG + Intergenic
1039248598 8:35636425-35636447 GCACCCAGTGGGTACAGCTCAGG - Intronic
1039365020 8:36920131-36920153 GAACCAACTGTGTACAGCTCAGG - Intronic
1039783894 8:40815541-40815563 TCAACCACAGGGCACAGCTGAGG + Intronic
1040287536 8:46108128-46108150 GCACCCCCGGGACACAGCTGGGG + Intergenic
1040333472 8:46404244-46404266 CAACCCACTTGGAACAGCTTTGG - Intergenic
1041632783 8:60106827-60106849 AAACCTAATGGGCACAGCTTTGG - Intergenic
1042877347 8:73451388-73451410 GATCCCACTGAGCTCAGTTGGGG + Intronic
1045933765 8:107655875-107655897 GAGCCCACTGGGCAGGGCTCAGG - Intergenic
1046695250 8:117332744-117332766 GAACCCACTGGGAATGGGTGAGG + Intergenic
1047928246 8:129701771-129701793 GAAACAGCTGGGCCCAGCTGAGG + Intergenic
1048444792 8:134485270-134485292 CAGGCCACTGTGCACAGCTGTGG + Intronic
1048986240 8:139736625-139736647 GGACCCCCAGGGTACAGCTGAGG + Intronic
1049416798 8:142499068-142499090 TCCCCCACTTGGCACAGCTGGGG - Intronic
1049432836 8:142573278-142573300 GAGCACACTGGGGACAGCAGCGG - Intergenic
1049578925 8:143402066-143402088 GAACCCACGTGGCACACCTGGGG - Intergenic
1049884683 9:19082-19104 GAATGCACTTGGCACATCTGGGG - Intergenic
1050064288 9:1742608-1742630 GATCTAACTGGGCACAGCAGAGG - Intergenic
1051740702 9:20248987-20249009 GAGCCCAGTGGACACAGCAGAGG + Intergenic
1052530829 9:29682271-29682293 GACCACTCTGGGCACAGTTGAGG + Intergenic
1056365395 9:85899577-85899599 CAACTCACTGGCCACAGCAGGGG + Intergenic
1057054318 9:91949503-91949525 GGACCCTCGGGGCACATCTGCGG + Intronic
1057911327 9:99022504-99022526 GGACACACTGGGCAGGGCTGGGG - Intronic
1058324181 9:103674901-103674923 GAATCCACTGGTCAAATCTGGGG - Intergenic
1059321830 9:113476189-113476211 AAACGCAGTGGGCACAGCAGAGG + Intronic
1059348988 9:113651148-113651170 GAAAACACTGGACACAGGTGAGG + Intergenic
1059880513 9:118683792-118683814 ATACCCACTGGGGACAGCTTAGG - Intergenic
1060220664 9:121762520-121762542 GAACCCAGGGTGCACAGCAGAGG - Intronic
1060343548 9:122797443-122797465 GAACCCAGAGGGTACACCTGGGG + Intergenic
1060445357 9:123682089-123682111 AAATCCACTGGGCTCTGCTGAGG - Intronic
1062021281 9:134320529-134320551 TTCCCCACTGGGCACAGCTGTGG - Intronic
1062428685 9:136517429-136517451 TGCCCCACTGGGCACAGCTGTGG + Intronic
1189282219 X:39826917-39826939 GATCCCACAGCGCGCAGCTGAGG - Intergenic
1191127691 X:56975039-56975061 GAACCTTCTGGTAACAGCTGGGG + Intergenic
1191631388 X:63325674-63325696 GAACCCACTGAGCAATGATGGGG - Intergenic
1192111784 X:68372320-68372342 TAACCCACTGTGCCCGGCTGTGG - Intronic
1192901712 X:75505993-75506015 GAAACCACTAGGCAAAGATGAGG + Intronic
1200401124 X:156021070-156021092 GAATGCACTTGGCACATCTGGGG + Intergenic