ID: 1175199342

View in Genome Browser
Species Human (GRCh38)
Location 20:57266908-57266930
Sequence GGCGGCCCGAGCAGGACGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175199331_1175199342 8 Left 1175199331 20:57266877-57266899 CCCTCTCGGCACTCGCGGTCCGG 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1175199342 20:57266908-57266930 GGCGGCCCGAGCAGGACGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 183
1175199328_1175199342 13 Left 1175199328 20:57266872-57266894 CCCTGCCCTCTCGGCACTCGCGG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1175199342 20:57266908-57266930 GGCGGCCCGAGCAGGACGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 183
1175199330_1175199342 12 Left 1175199330 20:57266873-57266895 CCTGCCCTCTCGGCACTCGCGGT 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1175199342 20:57266908-57266930 GGCGGCCCGAGCAGGACGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 183
1175199327_1175199342 17 Left 1175199327 20:57266868-57266890 CCGGCCCTGCCCTCTCGGCACTC 0: 1
1: 1
2: 3
3: 74
4: 529
Right 1175199342 20:57266908-57266930 GGCGGCCCGAGCAGGACGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 183
1175199333_1175199342 7 Left 1175199333 20:57266878-57266900 CCTCTCGGCACTCGCGGTCCGGA 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1175199342 20:57266908-57266930 GGCGGCCCGAGCAGGACGGGTGG 0: 1
1: 0
2: 2
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175199342 Original CRISPR GGCGGCCCGAGCAGGACGGG TGG Intergenic