ID: 1175202063

View in Genome Browser
Species Human (GRCh38)
Location 20:57284852-57284874
Sequence CAGTCTCTGGTGATGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175202063_1175202068 14 Left 1175202063 20:57284852-57284874 CCTGCTTCCATCACCAGAGACTG No data
Right 1175202068 20:57284889-57284911 ATGCTTAGTATTTGACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175202063 Original CRISPR CAGTCTCTGGTGATGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr