ID: 1175204363

View in Genome Browser
Species Human (GRCh38)
Location 20:57300541-57300563
Sequence AAAGCTGCAGAGGTACAGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175204363_1175204372 -5 Left 1175204363 20:57300541-57300563 CCCGACTGTACCTCTGCAGCTTT No data
Right 1175204372 20:57300559-57300581 GCTTTCTGGCTGGGGGATCAGGG No data
1175204363_1175204371 -6 Left 1175204363 20:57300541-57300563 CCCGACTGTACCTCTGCAGCTTT No data
Right 1175204371 20:57300558-57300580 AGCTTTCTGGCTGGGGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175204363 Original CRISPR AAAGCTGCAGAGGTACAGTC GGG (reversed) Intergenic
No off target data available for this crispr