ID: 1175213253

View in Genome Browser
Species Human (GRCh38)
Location 20:57375086-57375108
Sequence CACTTTATGAAGGGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175213242_1175213253 11 Left 1175213242 20:57375052-57375074 CCTGGGCACAGAAGCACAGGCAA 0: 1
1: 0
2: 1
3: 22
4: 301
Right 1175213253 20:57375086-57375108 CACTTTATGAAGGGGGTGGCAGG 0: 1
1: 0
2: 0
3: 16
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175213253 Original CRISPR CACTTTATGAAGGGGGTGGC AGG Intronic
900479479 1:2891205-2891227 CTCTTTGTGGAGGGGGTGGGGGG - Intergenic
900707831 1:4091302-4091324 CACTTTACAAAGGGGGAAGCAGG - Intergenic
902818014 1:18927091-18927113 CACCTTCGAAAGGGGGTGGCTGG - Intronic
902888623 1:19425200-19425222 CATTGTATGAAGGAGGTGCCTGG - Intronic
905010493 1:34743673-34743695 CACTTTTTGAAGGCAGTGGACGG - Intronic
905817200 1:40960846-40960868 CACTTTGGGAGGCGGGTGGCGGG + Intergenic
906400935 1:45504166-45504188 CACTTTAGGGAGGCGGAGGCGGG + Intronic
908489028 1:64624456-64624478 CTTTTTATTAAGGGGTTGGCAGG + Intronic
908944991 1:69484844-69484866 CTCTTTATGAAGGAGGAAGCTGG + Intergenic
909128421 1:71706108-71706130 GACTTGGGGAAGGGGGTGGCTGG - Intronic
909319510 1:74265516-74265538 CCCTTTATGAAGAGTGTGGCAGG - Intronic
912666111 1:111581090-111581112 CCCTTTATGAAGTGGGATGCAGG + Intronic
915078819 1:153337254-153337276 CCATTTATGAAGGGGTGGGCTGG - Exonic
915540939 1:156565766-156565788 CCCATTATGCAGGGGGTGGGAGG - Intronic
917289896 1:173461174-173461196 CACAGTATGTAGGGGGTGGCTGG - Intergenic
918045377 1:180937988-180938010 CACTTTATGGAGGAGGATGCTGG - Intronic
918182006 1:182092183-182092205 CCATTTATGATGGGGGAGGCTGG - Intergenic
918329258 1:183441681-183441703 CACTTGATGAAGGGGGTGAGAGG + Intergenic
918441834 1:184575801-184575823 CACTGTATTAAGGGGTTGGGGGG - Intronic
922304611 1:224333223-224333245 GCCTTTAAGAAGGAGGTGGCTGG - Intergenic
923653990 1:235899729-235899751 CACTGTCTCAAGGGGGTGGGAGG + Intergenic
1063609647 10:7552016-7552038 CTCATTATGTAGGGGGTGGAGGG - Intergenic
1067304962 10:45055057-45055079 CACCTTATGAGGGGTGCGGCAGG - Intergenic
1073699512 10:105910035-105910057 GAGTATATGAAGGGGGTGGGAGG + Intergenic
1076162431 10:128255826-128255848 CAAATTATGAAGGTGGTGGAGGG + Intergenic
1077014540 11:393842-393864 CCCTTCATGCTGGGGGTGGCAGG + Intronic
1077573753 11:3361261-3361283 CACATTATAAAGGTTGTGGCAGG + Intronic
1078160775 11:8837905-8837927 GAGTTTATGAAGGAGGTGGAAGG + Intronic
1079138523 11:17792098-17792120 CACTCTATCAAGAGGGTAGCTGG + Intronic
1079312846 11:19381614-19381636 TATTTGATGAAGGTGGTGGCAGG + Intronic
1083330823 11:61897644-61897666 GCCTTTATGAAGGGGGAGGGAGG + Exonic
1084904326 11:72334410-72334432 CACTTTAGGAAGGCTGAGGCAGG + Intronic
1087050748 11:93884144-93884166 CTCTAAATGAAGGGGCTGGCTGG + Intergenic
1088167073 11:106951570-106951592 CACTTTATGATGGGGTTGTTTGG + Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089607078 11:119647636-119647658 TCCTTAATGGAGGGGGTGGCGGG + Intronic
1093140615 12:15506564-15506586 CACCTTATTCAGAGGGTGGCAGG + Intronic
1094274290 12:28653827-28653849 CACTTTAGGGAGGGTGAGGCTGG + Intergenic
1095969443 12:47891768-47891790 CACTTGATGATGGGGGAGGTGGG - Intronic
1096323023 12:50632074-50632096 CACTTTTGGAAGGCGGAGGCGGG - Intronic
1099139957 12:78960622-78960644 CATGTTATGAAGGGGGCTGCAGG + Intronic
1101253608 12:102957333-102957355 GGCTTTAGGAAGGGGGTGGGGGG - Intronic
1102799219 12:115717109-115717131 GATTATATGAAAGGGGTGGCAGG - Intergenic
1104509374 12:129362419-129362441 CACTTTCAGACGGGGGTGGGCGG - Intronic
1106157051 13:27169223-27169245 AACTGTATGAAGGGGATGGAGGG + Intronic
1106457541 13:29940248-29940270 CACTATACGATGGGGGTGGCAGG + Intergenic
1106787594 13:33122577-33122599 CCCTTTCTCAAGAGGGTGGCTGG - Intronic
1106889356 13:34226625-34226647 AGCTTTATGGTGGGGGTGGCTGG - Intergenic
1110069710 13:71158903-71158925 CACATTATTAAGGGGTTGGGGGG - Intergenic
1112055973 13:95690756-95690778 CACTTTCCGGATGGGGTGGCTGG + Intronic
1112898121 13:104326509-104326531 CACTTTATGAAGGCGGAGGGAGG + Intergenic
1113120739 13:106921508-106921530 CACTTCATCAAGTGGGTGACAGG - Intergenic
1113899967 13:113791305-113791327 CACTTTCAGAAGTGGGTGGCAGG - Intronic
1113929174 13:113957402-113957424 CACTTGATGAAAGGGGGTGCAGG - Intergenic
1113929364 13:113958178-113958200 CACTTGATGAAAGGGGGTGCAGG - Intergenic
1114531543 14:23399719-23399741 CATTTCATGAAGGCCGTGGCTGG + Intronic
1115837588 14:37426283-37426305 TACTTTATGTAGGGGGTTGGAGG - Intronic
1117100676 14:52343232-52343254 CACATCATCAAGGGGGTGGTGGG + Intergenic
1118691829 14:68347383-68347405 GACTTTAAGAAGTAGGTGGCTGG + Intronic
1118737009 14:68708411-68708433 TCCTTGATGAAGCGGGTGGCCGG + Intronic
1119187629 14:72654102-72654124 CACTGTAGGAAGGAGGAGGCTGG - Intronic
1119839228 14:77778621-77778643 CACCTTATGAAGAAGGTGTCTGG + Intergenic
1125672379 15:41483457-41483479 TTCTTTTTGAAGGGAGTGGCAGG - Exonic
1126511550 15:49480777-49480799 CACTTTACAAAGGGGATGGCTGG - Intronic
1126547659 15:49890407-49890429 CAGTTTAGGAGAGGGGTGGCAGG + Intronic
1129168439 15:73793091-73793113 CACTTGAGGTAGGGGGTGGGCGG - Intergenic
1130879465 15:88042693-88042715 CACTTAAGGAAGGGGAAGGCAGG + Intronic
1131308863 15:91269621-91269643 CACTTTAGGAAAGGAATGGCTGG + Intronic
1133106920 16:3517669-3517691 CTCTTGATTAAGGGGGTGACTGG - Intronic
1133908886 16:10046807-10046829 CACCCTCTGAAGGGGGTGGTAGG - Intronic
1135204104 16:20467886-20467908 CAGTTTGTGAAGGAGGTTGCTGG - Intronic
1141196494 16:81865234-81865256 CACTCTCTGTAGGGGATGGCAGG + Intronic
1142369171 16:89668656-89668678 CACTCCACGAAGGGGGTGGGCGG + Intronic
1142896324 17:2981388-2981410 CAGTTTGTGAAGGGGTGGGCAGG - Intronic
1144387536 17:14763345-14763367 CTCTATATAAATGGGGTGGCAGG + Intergenic
1146950538 17:36902326-36902348 AACTGTGTGAAGGGAGTGGCAGG + Intergenic
1147570943 17:41570581-41570603 GACTTCAGGAAGGAGGTGGCTGG + Intronic
1151547046 17:74799560-74799582 CACTTCTTCAAGGGGGTGTCCGG - Intronic
1151705080 17:75763226-75763248 TGCCTTATGGAGGGGGTGGCAGG - Intronic
1152340810 17:79723385-79723407 CAGGGTATGAAGGGGGTGGAGGG + Intergenic
1157901059 18:51518158-51518180 CACTTTATGAAGGGATTGAATGG + Intergenic
1160235720 18:77084938-77084960 CACATTAAGAAGGGGGAGGGGGG + Intronic
1160516380 18:79481368-79481390 CACTTTTTTGAAGGGGTGGCAGG - Intronic
1160609916 18:80076934-80076956 GACTTTATGAAAGGGCTGGCGGG - Intronic
1163722603 19:18905353-18905375 CTCTCTATGCAGTGGGTGGCAGG - Intronic
1164931542 19:32179618-32179640 CATTTAGTGAAAGGGGTGGCTGG - Intergenic
1165889980 19:39105926-39105948 CACTTTATGGTGGAGATGGCTGG - Intronic
1167474888 19:49694328-49694350 CAGTTAAATAAGGGGGTGGCAGG + Intronic
1167479424 19:49720487-49720509 CAGGTTATAAAGGGTGTGGCTGG - Intergenic
1167492238 19:49799523-49799545 GTCTTTCTGAGGGGGGTGGCAGG - Intronic
927642482 2:24854126-24854148 GACTTTCGGTAGGGGGTGGCAGG + Intronic
928085534 2:28344234-28344256 GACTTTAAGAAGGGGGTGGTGGG - Intergenic
931674401 2:64679646-64679668 CTCTTTTTGAAGGGGGAGGGTGG - Intronic
932366240 2:71155241-71155263 CAGTTCATGAAGGTGCTGGCAGG + Intergenic
932750874 2:74370950-74370972 CTCTGGATGAAGGGGGTGGCTGG - Intronic
936943369 2:117908526-117908548 CATTTTATGAAGGGAGAGGTGGG - Intergenic
937714129 2:125012236-125012258 CACATAGTGAAAGGGGTGGCAGG - Intergenic
939233907 2:139466899-139466921 CATTTTAGGGAGGGGGTGGAAGG + Intergenic
942094047 2:172521291-172521313 CATTTGATGAAGGAGGGGGCAGG + Intergenic
943344915 2:186727069-186727091 TACTAAATGAAGGGGGTGGGGGG - Intronic
946067701 2:217003392-217003414 CACTTTGTAAGGAGGGTGGCTGG - Intergenic
946741740 2:222809162-222809184 TACTTTAAAAAGGGGGTGACAGG + Intergenic
947717582 2:232349645-232349667 CACTGGCTGAAGGGAGTGGCAGG - Intergenic
947722542 2:232378625-232378647 CACTGGCTGAAGGGAGTGGCAGG - Exonic
947726879 2:232406718-232406740 CACTGGCTGAAGGGAGTGGCAGG - Intergenic
948295107 2:236854947-236854969 CACTTTAAGAAGGCTGAGGCAGG - Intergenic
1170198954 20:13721535-13721557 CACCTGAAGAAGGGTGTGGCAGG + Intronic
1170559597 20:17545460-17545482 AACATTATGAAGGAGGGGGCCGG + Intronic
1170685326 20:18564435-18564457 CACAGAATGTAGGGGGTGGCAGG + Intergenic
1170775505 20:19371592-19371614 CCCTGTATGTAGGGGGTGGTGGG - Intronic
1172410135 20:34715170-34715192 CACTTTATGAAACAGGTTGCAGG + Exonic
1175213253 20:57375086-57375108 CACTTTATGAAGGGGGTGGCAGG + Intronic
1176853173 21:13936877-13936899 CACTTTGTAGACGGGGTGGCGGG + Intergenic
1180606737 22:17064689-17064711 CACTTTAGGCAGGCGGTGACAGG + Intergenic
1180725195 22:17941850-17941872 CACTTTAGAATGGGGGTGGGAGG - Intronic
1181463471 22:23098545-23098567 CACTTTCTAAAGGGAGGGGCTGG + Intronic
1182411568 22:30191357-30191379 AACTTTCTGAAGGAGGTGGCTGG + Intergenic
1183676514 22:39301805-39301827 CACCTGAGGAAGGGGGCGGCAGG - Intergenic
951079988 3:18443248-18443270 GACTTTCTCAAGGGGGTGGCGGG - Intronic
953381321 3:42474745-42474767 CCCTATGAGAAGGGGGTGGCTGG - Intergenic
954342407 3:49965828-49965850 TACTTTAAGAAAGGGTTGGCCGG + Intronic
954439778 3:50515524-50515546 CACTTCATGGAGAGGGGGGCAGG + Intergenic
957309566 3:78502275-78502297 CATTTAATGAAGTGGGTGGCAGG - Intergenic
960160556 3:114345891-114345913 CTCTTGATGAAGGGGGTAGAGGG + Intronic
960174202 3:114497936-114497958 CACTTTCTGATGGGTATGGCAGG + Intronic
962834987 3:139181956-139181978 GGCTTTCTGAAGGAGGTGGCAGG - Intronic
963298357 3:143572586-143572608 CACTTTATTAAGGAGGTAGCTGG - Intronic
963562260 3:146880734-146880756 CATTTTATTAATGGGGTAGCTGG + Intergenic
975245180 4:72112234-72112256 CACTTTAAGAAGTGGGAGGGAGG + Intronic
976760534 4:88544231-88544253 CACTTTTTGAAGGGGTTGTTTGG - Intronic
977297976 4:95232023-95232045 CATTTTCAGAAGGGTGTGGCTGG - Intronic
977491985 4:97726045-97726067 CATTTTATAGAGGTGGTGGCAGG - Intronic
978241405 4:106521046-106521068 CACCCTATGAAGTGGTTGGCTGG - Intergenic
978441319 4:108737270-108737292 CACTTTGTGAAGAGGGTGGAGGG - Intergenic
981589248 4:146339584-146339606 CTCTTTGTGTTGGGGGTGGCAGG - Intronic
982274960 4:153629157-153629179 CACTATGTGAAGTGGGTGGTGGG - Intronic
983661449 4:170134008-170134030 GCCTTGATGAAGGTGGTGGCTGG + Intergenic
986022946 5:3821841-3821863 AACTGTATAAAGGGGATGGCAGG - Intergenic
991341248 5:65612571-65612593 CACTTTAAGAAGGCTGAGGCAGG + Intronic
992519357 5:77534322-77534344 CACTATATGTGGGGGGCGGCGGG + Intronic
992750854 5:79859278-79859300 CACATCATGAAAGGGGAGGCAGG + Intergenic
992869742 5:80994103-80994125 CACTTTAAGAAGGGGTAGTCTGG + Intronic
994968343 5:106702809-106702831 CACTTTCTTCAGGAGGTGGCAGG - Intergenic
996870850 5:128191764-128191786 CAGTTTGGGAAGGAGGTGGCTGG + Intergenic
1000043549 5:157502962-157502984 CACTTTGGGAAAGGGGTGCCTGG + Exonic
1000166229 5:158651230-158651252 CAATATATGAATGGGGTGGGAGG + Intergenic
1002911603 6:1495125-1495147 CACTTTCTGTTGGGGGTGGGGGG - Intergenic
1002936891 6:1681639-1681661 CACTTTATGGTGGGGGTTGCTGG - Intronic
1004162207 6:13224468-13224490 CAAATTATGTAGGGTGTGGCAGG + Intronic
1005081968 6:21965438-21965460 CCCTTAATGAAAGGGGTGGTGGG - Intergenic
1006626203 6:35399718-35399740 CCCTGTATGAAGAGGGTGGTAGG - Intronic
1010026668 6:71226316-71226338 TCCTTTTTGAAGGTGGTGGCAGG + Intergenic
1011260387 6:85464505-85464527 CACTTTATGGGGTGGGTGTCAGG + Intronic
1015407858 6:132857488-132857510 TGTTTTATGAATGGGGTGGCAGG + Intergenic
1016653384 6:146488805-146488827 CACTCTAGGAAGGGAGTGACGGG + Intergenic
1017108370 6:150909487-150909509 CACTTTTTGGAGGTGGAGGCGGG - Intronic
1021231442 7:18090138-18090160 CATTTTAGGAAGGAGGCGGCAGG + Intronic
1021840673 7:24719342-24719364 CTCATGATGAAAGGGGTGGCAGG + Intronic
1022443691 7:30453039-30453061 CACTGGAGGGAGGGGGTGGCAGG + Exonic
1023604705 7:41918976-41918998 CAGGTTATGAAAGAGGTGGCTGG + Intergenic
1023873832 7:44276431-44276453 CCCTTTGTGCAGTGGGTGGCGGG - Intronic
1023925930 7:44669637-44669659 CATCATATGAAGGGGGTGGAGGG + Intronic
1024378352 7:48664869-48664891 CACTTTTTTGTGGGGGTGGCGGG - Intergenic
1025057985 7:55780418-55780440 CACTTTATGAATGGCCCGGCCGG - Intergenic
1026399598 7:69996201-69996223 AAATTTATGAAGGGGGTTCCAGG - Intronic
1026791649 7:73336429-73336451 GACTTGATGAAGTGGATGGCAGG + Intronic
1027810375 7:82889009-82889031 CTCTTTATCAAGGGGGTGAGGGG + Intronic
1031009111 7:116505680-116505702 CACGTTACCAAGAGGGTGGCAGG + Intronic
1031621513 7:123939329-123939351 CACTTTAGGAAGGCCGAGGCGGG - Intronic
1033485223 7:141782344-141782366 CACTTTCTGAAGTGGAGGGCAGG + Intronic
1034530049 7:151689896-151689918 CACATCATGAAGGGAGAGGCAGG + Intronic
1035440991 7:158899742-158899764 CACTTCTTGAACGTGGTGGCAGG - Intronic
1036555495 8:9856030-9856052 CACTTAGGGAAGAGGGTGGCAGG + Intergenic
1037178422 8:15974170-15974192 CATTTTCTGAAGGGGATGGTAGG + Intergenic
1039192101 8:34987758-34987780 CACTTTGTTAAGGTGATGGCTGG + Intergenic
1040567603 8:48581819-48581841 CACTTCATAAAGCGGTTGGCCGG + Intergenic
1041762978 8:61386851-61386873 CACTTAATGAAAGGGGTGTAGGG - Intronic
1043131048 8:76461787-76461809 CAGTTTATGGTGGGGGTGGAAGG + Intergenic
1044433259 8:92133780-92133802 TACTTTATGACGGGGGTGAGGGG + Intergenic
1045184692 8:99825404-99825426 CACTTTCTGATGGGGTTGGTTGG + Intronic
1046528456 8:115412909-115412931 CATTTAATGAAGGGATTGGCTGG + Exonic
1052564003 9:30123101-30123123 TACTTTAGGAAATGGGTGGCCGG - Intergenic
1052817520 9:33112949-33112971 CACTGAAAGAAGGGGGTGGGGGG + Exonic
1057022841 9:91713943-91713965 CAGTTTAAGAAGGGGGGGGGGGG - Intronic
1058745781 9:107989272-107989294 GACTTTTTCAAGGGGGTTGCAGG + Intergenic
1059236828 9:112768035-112768057 CACTTTATGAAGGTGGATTCTGG - Intronic
1059681043 9:116586632-116586654 CACTATAGGAAGGGGGAGGGAGG + Intronic
1189381698 X:40506847-40506869 GACTTCATGGAGGGGGTGGAGGG + Intergenic
1189499190 X:41539174-41539196 CACTTTATGATGGGAGTTGTAGG + Intronic
1190817030 X:53938178-53938200 GACATTATGGAGGGTGTGGCGGG - Exonic
1192122053 X:68465632-68465654 CACTTGATTAAGGTGGTGTCTGG - Intergenic
1194430381 X:93796366-93796388 CACTTTGGGGAGGTGGTGGCAGG + Intergenic
1195683235 X:107564226-107564248 CAGTGTATGAAGGAGGTGGGAGG - Intronic
1196035157 X:111135995-111136017 CACTTTAGGTAGAAGGTGGCAGG + Intronic
1197261714 X:124326760-124326782 CTCTTTAAGAATGGGATGGCTGG - Intronic