ID: 1175213315

View in Genome Browser
Species Human (GRCh38)
Location 20:57375416-57375438
Sequence CCCCATCGGAAGCCAGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 168}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175213315_1175213325 3 Left 1175213315 20:57375416-57375438 CCCTGCCCTGGCTTCCGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 1175213325 20:57375442-57375464 TCACCTGCTTCACATAGGAGGGG 0: 1
1: 0
2: 1
3: 18
4: 129
1175213315_1175213322 -2 Left 1175213315 20:57375416-57375438 CCCTGCCCTGGCTTCCGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 1175213322 20:57375437-57375459 GGAGGTCACCTGCTTCACATAGG 0: 1
1: 0
2: 0
3: 14
4: 91
1175213315_1175213323 1 Left 1175213315 20:57375416-57375438 CCCTGCCCTGGCTTCCGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 1175213323 20:57375440-57375462 GGTCACCTGCTTCACATAGGAGG 0: 1
1: 0
2: 0
3: 10
4: 111
1175213315_1175213327 13 Left 1175213315 20:57375416-57375438 CCCTGCCCTGGCTTCCGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 1175213327 20:57375452-57375474 CACATAGGAGGGGCTTCCAGTGG 0: 1
1: 0
2: 1
3: 22
4: 198
1175213315_1175213324 2 Left 1175213315 20:57375416-57375438 CCCTGCCCTGGCTTCCGATGGGG 0: 1
1: 0
2: 0
3: 6
4: 168
Right 1175213324 20:57375441-57375463 GTCACCTGCTTCACATAGGAGGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175213315 Original CRISPR CCCCATCGGAAGCCAGGGCA GGG (reversed) Intronic
900697041 1:4018996-4019018 CCCCATTGGATGTCAGGCCAAGG + Intergenic
902406281 1:16185262-16185284 CCTCAGCGGACTCCAGGGCAGGG + Intergenic
902561041 1:17277704-17277726 CCCCAGCAGGAGCCTGGGCATGG + Intronic
902923883 1:19683108-19683130 CCCCATCTGCAGCCATGGCATGG - Exonic
903239168 1:21971146-21971168 CACCATGGGAACCCAGGGCTAGG - Intergenic
903243075 1:21996822-21996844 CACCATGGGAACCCAGGGCTAGG - Intronic
903490510 1:23724658-23724680 ACCCATCGTAGGCAAGGGCATGG + Intergenic
905017136 1:34785566-34785588 CCCCATCTGACCACAGGGCAGGG + Exonic
906649536 1:47502964-47502986 CCCCCTCTGAAGCCAGCGAAGGG - Intergenic
911059863 1:93738613-93738635 CCCCATCAGAGGGCTGGGCAGGG + Intronic
916211140 1:162360888-162360910 CTCCATCAGAAGTGAGGGCAGGG - Intronic
918400560 1:184158522-184158544 CCCCATAGGCTGCCATGGCAGGG - Intergenic
919271928 1:195359754-195359776 CACCCTTGGAAGCCATGGCATGG + Intergenic
920683463 1:208090853-208090875 CACCATGGGAGGCCTGGGCAGGG - Intronic
920789699 1:209078126-209078148 CCCCATTAGCAGCTAGGGCATGG - Intergenic
922571976 1:226639751-226639773 CCCCATCTGAACCTGGGGCAGGG + Intronic
922798991 1:228355569-228355591 CCCCAGGGGATGCCTGGGCAGGG - Intronic
1067107762 10:43377071-43377093 CCCAATCTGAGGCCAGGGCTTGG + Intergenic
1068009083 10:51425566-51425588 CCCTTTCGGAAGCCACAGCAGGG + Intronic
1068251447 10:54447394-54447416 CATCATCAGAAGCTAGGGCATGG - Intronic
1069575365 10:69523571-69523593 CCCGATAGGAAGCCAAGCCAAGG + Intergenic
1069988356 10:72298975-72298997 GGCCATCAGAGGCCAGGGCAGGG - Intergenic
1072667080 10:97401401-97401423 CCCCATCCGAAGCCAGGAGGAGG - Intronic
1072805841 10:98423715-98423737 CCCCCTGGGTGGCCAGGGCAGGG - Intronic
1072814369 10:98490105-98490127 CTCCAGCGGAAGCCACGGCCTGG - Exonic
1074861245 10:117512089-117512111 TCCCATAGGAACCCTGGGCAGGG - Intergenic
1075484843 10:122813871-122813893 GCCCATGGGAGGCCAGGGCTAGG + Intergenic
1075484877 10:122814031-122814053 GCCCATGGGAGGCCAGGGCTGGG + Intergenic
1075484896 10:122814111-122814133 GCCCATGGGAGGCCAGGGCTGGG + Intergenic
1075484934 10:122814269-122814291 GCCCATGGGAGGCCAGGGCCGGG + Intergenic
1076509085 10:130999483-130999505 GCCCACCTGAAGGCAGGGCAGGG - Intergenic
1077218396 11:1404614-1404636 CCACATCAGGAACCAGGGCAGGG - Intronic
1078845928 11:15118278-15118300 CCTCATCTGAATGCAGGGCAGGG + Intronic
1079388104 11:19998531-19998553 CCCCCTTGGAGGCCACGGCAAGG - Intronic
1079402817 11:20119458-20119480 CCCCACCGGAAGCTGGGGCGGGG - Intronic
1081812495 11:45921938-45921960 CCCCATAGCAGGCCAGGGAATGG - Intronic
1085506408 11:77063290-77063312 CCCTAAAGGAAGCCATGGCATGG - Intergenic
1089273232 11:117315763-117315785 CCACAGCAGGAGCCAGGGCAGGG + Exonic
1091300184 11:134502561-134502583 CACCAGCAGAAGCCCGGGCAGGG - Intergenic
1096534151 12:52260109-52260131 TCCCAGCTGAAGCCGGGGCAGGG - Intronic
1097020293 12:56016008-56016030 TTCCCTAGGAAGCCAGGGCATGG - Intronic
1099793241 12:87363316-87363338 CCCCCTAGGAACTCAGGGCAAGG + Intergenic
1103354917 12:120312546-120312568 CACCATCAGGAGCCAGGCCATGG - Exonic
1104795375 12:131513453-131513475 CCCCGTGGACAGCCAGGGCATGG - Intergenic
1104873941 12:132019939-132019961 GCCCATAGGAAGCCAGCTCAGGG - Intronic
1117820569 14:59644846-59644868 CCCCATGAGAAGCAAGGCCAGGG - Intronic
1119478792 14:74947103-74947125 CTCCCTTGGGAGCCAGGGCAAGG + Intronic
1119539620 14:75429270-75429292 CCCTGTTGGAATCCAGGGCATGG + Intronic
1121168691 14:91835860-91835882 CGCCGTCGGAAGCCCGAGCACGG + Intronic
1122123488 14:99566917-99566939 CACCTCAGGAAGCCAGGGCACGG - Intronic
1122347003 14:101066991-101067013 GCCAACCGGAAGCAAGGGCATGG - Intergenic
1202921833 14_KI270723v1_random:34700-34722 TCCCAGCGGAAGCCTGGGGACGG + Intergenic
1202923083 14_KI270724v1_random:2881-2903 TCCCAGCGGAAGCCTGGGGACGG - Intergenic
1124037544 15:26069695-26069717 CCCCAGAAGAAGCCTGGGCAGGG + Intergenic
1124241354 15:28030638-28030660 CCCAGTCTGCAGCCAGGGCAGGG - Intronic
1124255194 15:28135533-28135555 CTCCTTCTGAAGACAGGGCAAGG + Exonic
1124569117 15:30844084-30844106 CTCCTTCTGAAGACAGGGCAAGG - Intergenic
1125810774 15:42539231-42539253 CACTATGGGAAGCCAAGGCAGGG + Exonic
1125987599 15:44070177-44070199 ACCCATAGGAAACCAGGGCTGGG + Intronic
1127921121 15:63494855-63494877 CACTTTGGGAAGCCAGGGCAGGG + Intergenic
1128286219 15:66439115-66439137 ATCCAGAGGAAGCCAGGGCAGGG - Intronic
1129341510 15:74889553-74889575 CCACAGCGGAAGCCAGAGCAAGG - Intergenic
1130292924 15:82620550-82620572 CACTTTCGGAAGCCAAGGCAAGG + Intronic
1132246407 15:100299652-100299674 CCCCATCGGGATCCTGGGAATGG + Intronic
1137595708 16:49722168-49722190 CCCCATCAGAAGCCATCGGAGGG + Intronic
1139514244 16:67444021-67444043 CCGTATCAGAAGCCAGGGAAGGG - Intronic
1141818847 16:86431485-86431507 CCCAACCGGAAGCCAGGGAGAGG + Intergenic
1142021441 16:87785373-87785395 CCCCATCAGAAACCAGGGAGTGG - Intergenic
1142182703 16:88678959-88678981 CTCCAGCAGAATCCAGGGCAGGG + Intronic
1142885543 17:2910194-2910216 CCCCACCCTAAGCCAGGGCCTGG - Intronic
1143565446 17:7717715-7717737 CCCCATGGCAACCCCGGGCAGGG - Exonic
1143689928 17:8552833-8552855 CCCCCTGGGAAGCCCAGGCAGGG - Intronic
1143850093 17:9804426-9804448 GCCCATTGGAAGGCAGGGAAGGG + Intronic
1144631329 17:16873943-16873965 CACCAGCAGAAGCCAGGGAAGGG - Intergenic
1144649271 17:16997331-16997353 CACCAGCAGAAGCCAGGGAAGGG + Intergenic
1144669065 17:17121596-17121618 CCCCATCGGCAGCAGGGGAAGGG + Intronic
1145246678 17:21274130-21274152 CCTCATGGGAAGCCAGAGCCAGG - Intergenic
1146056207 17:29582580-29582602 CCCCAAAGGCAGCCAGGTCAGGG - Intronic
1146938692 17:36828522-36828544 ACCCATCTGAAGCCATGGGAAGG + Intergenic
1151403604 17:73872353-73872375 CCCCATGCAAAGCCAGGTCAAGG + Intergenic
1151527825 17:74682988-74683010 TCCCATGGTAATCCAGGGCAAGG + Intronic
1151722479 17:75865360-75865382 AACAATGGGAAGCCAGGGCATGG - Intergenic
1153473477 18:5471261-5471283 CGCCATCTGAACCCAGGGAAAGG + Intronic
1153815167 18:8784801-8784823 CCCCATCGGGAACCTGGGGAAGG + Exonic
1156437057 18:37143198-37143220 CACTTTGGGAAGCCAGGGCAGGG - Intronic
1157740819 18:50091091-50091113 CCCCACCTGAAGACAGGGAAGGG + Intronic
1160723613 19:608199-608221 CCCCATCAGAACCCAGGCCGGGG - Intronic
1161224600 19:3137305-3137327 CCCCATCTGAAGCCTCCGCATGG - Intronic
1161280819 19:3444603-3444625 GGCCAGCGGCAGCCAGGGCAGGG - Intronic
1162819109 19:13212138-13212160 CCCCATGGAAGGCCAGGGCCGGG - Exonic
1163237260 19:16037081-16037103 CTCCATCGGAAGCTTTGGCATGG + Intergenic
1163861633 19:19746029-19746051 CCCCCTCAGATGCCAGGCCAGGG - Intergenic
1164776197 19:30855568-30855590 CCACATGGGAAGGCAGGCCAGGG - Intergenic
1165099648 19:33431364-33431386 CCCCGCCGGAGGCCAGGGCTGGG + Intronic
1165461355 19:35945908-35945930 CCCCAGGGGAAGCTGGGGCAGGG + Intergenic
1167232938 19:48296931-48296953 CCCCACAGAGAGCCAGGGCAGGG + Exonic
1168009813 19:53521197-53521219 CCCAGGAGGAAGCCAGGGCAGGG + Exonic
925282487 2:2694513-2694535 CCTCAGCAGTAGCCAGGGCAAGG - Intergenic
927508993 2:23632590-23632612 CCCCAGGGCAAGCCAGGGCCCGG + Intronic
927598919 2:24423146-24423168 GCCCATGGGAAGCCAGCTCAAGG + Intergenic
930230612 2:48840684-48840706 TGCCATCGGGAGCCAGGGCTTGG + Intergenic
932702448 2:74001131-74001153 CCCCCTGGGAACACAGGGCAGGG - Intronic
933607643 2:84400820-84400842 CCCCATCGTCAGGCAGGGCGTGG + Intergenic
933945533 2:87283149-87283171 CCCCATCTGAAGGCATGGAATGG - Intergenic
935146387 2:100398336-100398358 CCCGATCGGCAGGCTGGGCAAGG + Intronic
935232246 2:101109126-101109148 CCCCATAGGAAACCAGGGTTGGG + Intronic
936234595 2:110732460-110732482 CCGCCCGGGAAGCCAGGGCAGGG + Intergenic
936334677 2:111578440-111578462 CCCCATCTGAAGGCATGGAATGG + Intergenic
944602793 2:201320648-201320670 CCCCTGTGGAAGCCAGGGGATGG - Intronic
945135085 2:206618284-206618306 CCCCATTGGAGACCAGGCCAGGG + Exonic
947874779 2:233460919-233460941 TGCCCTCGGGAGCCAGGGCAGGG - Intronic
948719944 2:239893155-239893177 CCCAAAAGGAAGCCAGGGCAGGG + Intronic
948908906 2:240993225-240993247 CCCCATGAGCAGCCAGGGCAAGG - Intronic
1172750209 20:37245472-37245494 CCCCTGAGGAAGGCAGGGCAGGG - Intergenic
1174789250 20:53462517-53462539 CTCCTTCTGAAGCCAGGGCTGGG - Intronic
1175213315 20:57375416-57375438 CCCCATCGGAAGCCAGGGCAGGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176178919 20:63740602-63740624 CCCCGACGGAGGCCAGGTCAGGG + Intronic
1176241913 20:64079344-64079366 CCCCTTCGGCAGCCAGGGTGGGG - Exonic
1176376937 21:6091503-6091525 GCCCAGCGGGAGCCAGGTCAGGG - Intergenic
1179746538 21:43446741-43446763 GCCCAGCGGGAGCCAGGTCAGGG + Intergenic
951132885 3:19069069-19069091 CACCCTCGGAAGCCATGGCCTGG - Intergenic
951709451 3:25573945-25573967 CCCCACCTCAGGCCAGGGCAGGG + Intronic
962740605 3:138360493-138360515 CCCCACCAGCACCCAGGGCATGG - Intronic
967894434 3:194384808-194384830 ACCCAGCGCAATCCAGGGCAGGG + Intergenic
967975345 3:195031285-195031307 GTCCCTCGGCAGCCAGGGCAGGG + Intergenic
968931407 4:3581477-3581499 CCCCATCTGGAGCCAGGGCTGGG - Intronic
969448298 4:7257820-7257842 CCCAATGGGAGGCCAGGGCCAGG - Intronic
969531620 4:7733846-7733868 CCCCAGTGGGAGCCAGGTCAAGG + Intronic
969570753 4:8006785-8006807 CCTCATCTGCAGGCAGGGCAAGG - Intronic
969660074 4:8522250-8522272 CCCCGCCGAAAGGCAGGGCAAGG - Intergenic
969846961 4:9926932-9926954 CCCCGTCGGAAGCCAGAAGAGGG + Intronic
971349447 4:25843258-25843280 CCCCACCAGCAGCCAGTGCAAGG - Intronic
971756864 4:30718230-30718252 CCTCCTCCGAGGCCAGGGCAGGG - Intergenic
976877325 4:89869906-89869928 CCCCATCGCACGCCCTGGCAAGG + Intergenic
979693378 4:123584305-123584327 TCCCAGAGGCAGCCAGGGCAGGG - Intergenic
980329757 4:131395498-131395520 CCCAATTTGAAGCCAGGGCTGGG - Intergenic
984696667 4:182786259-182786281 GCAAATCGGAAGCCAGGGCTGGG + Intronic
996740726 5:126796259-126796281 CACCATAAGAAGACAGGGCAAGG - Intronic
1003153880 6:3574980-3575002 CCCCAGCAGGAGCCAGGGCCTGG - Intergenic
1004275636 6:14233058-14233080 GCCAATCTGAAGCCATGGCAGGG - Intergenic
1009411543 6:63370666-63370688 CCCCAGCTGAGGCCTGGGCAGGG + Intergenic
1010304918 6:74308717-74308739 CACCATGGGAAGACATGGCAAGG - Intergenic
1012442495 6:99274179-99274201 CCCCTTCTGAAGCCAGGCCTGGG - Exonic
1016340476 6:143057049-143057071 CCCCCTCAGAGGCCTGGGCATGG - Intergenic
1018982785 6:168613382-168613404 CCCCTTGGGGAGCCTGGGCATGG + Intronic
1023841085 7:44097790-44097812 CCCCATCAGAAGCCCAGCCAAGG - Intergenic
1027783498 7:82550177-82550199 AGCCATTGGAAGCCCGGGCATGG + Intergenic
1030233499 7:107233388-107233410 CCCCTTAGGAATCCAGGTCATGG - Intronic
1031948675 7:127868502-127868524 CCCCATGGGGAGCCATGGAAAGG - Intronic
1033468742 7:141623505-141623527 CCACATCCTAATCCAGGGCAAGG + Intronic
1034745842 7:153523508-153523530 GTCCATCGGGAGCCTGGGCATGG + Intergenic
1034944438 7:155253054-155253076 CCCAAGCGGAACCCAGGCCAAGG + Intergenic
1035717370 8:1764170-1764192 GCCCACCGGAAGGCAGGGCTGGG - Intronic
1038743340 8:30234732-30234754 GTCCACCGGAAGCCAAGGCATGG - Intergenic
1048437936 8:134434944-134434966 CTCCTTGGGAAGACAGGGCAGGG - Intergenic
1048438115 8:134436498-134436520 CCCCTTGGGAAGACAAGGCAGGG - Intergenic
1049352952 8:142173937-142173959 CCCCATCGAAATTCAGAGCAGGG - Intergenic
1050932642 9:11349421-11349443 CACCATGGGAAGCAATGGCAGGG - Intergenic
1051491259 9:17668901-17668923 CCCTCTCGGATGCCAAGGCAGGG - Intronic
1051735131 9:20190027-20190049 CCCACTGGGAAGCCATGGCAGGG + Intergenic
1053806851 9:41811253-41811275 TCCCATGGGACTCCAGGGCAAGG - Intergenic
1055198078 9:73621293-73621315 CACCTTCGGAGGCCAAGGCAGGG + Intergenic
1057229069 9:93308090-93308112 CCACCTCAGAAGCCAGGCCAGGG - Intronic
1059407161 9:114108401-114108423 CCCGAGAGTAAGCCAGGGCAGGG - Intergenic
1059537099 9:115090952-115090974 CACCTTCGGTAGCGAGGGCAAGG + Exonic
1059899525 9:118907687-118907709 CCCAACAGGAACCCAGGGCATGG - Intergenic
1059998810 9:119939698-119939720 TCCCATGGGAAGCCAAGGAAGGG - Intergenic
1061541544 9:131280217-131280239 GCGCTTCAGAAGCCAGGGCAGGG - Intergenic
1061582416 9:131545988-131546010 CCCCATCCGGAGCCAGGGTGGGG + Intergenic
1062262085 9:135667796-135667818 CCCCAGAGGAGGCCTGGGCATGG + Intergenic
1191996892 X:67105342-67105364 CCCCCTAGGAAGCTGGGGCAGGG + Intergenic
1195245156 X:102988651-102988673 CCCCATCAGAAGCAAGAGCATGG - Intergenic
1196029655 X:111082707-111082729 CCCCATGCTTAGCCAGGGCATGG - Intronic
1199743374 X:150756546-150756568 CCACATGGGTGGCCAGGGCATGG + Intronic