ID: 1175214215

View in Genome Browser
Species Human (GRCh38)
Location 20:57382242-57382264
Sequence TGTCCGCGATGGTTTCCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175214213_1175214215 2 Left 1175214213 20:57382217-57382239 CCTGATTTTTCTGTTTCAAACTT No data
Right 1175214215 20:57382242-57382264 TGTCCGCGATGGTTTCCTCGTGG No data
1175214212_1175214215 3 Left 1175214212 20:57382216-57382238 CCCTGATTTTTCTGTTTCAAACT No data
Right 1175214215 20:57382242-57382264 TGTCCGCGATGGTTTCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175214215 Original CRISPR TGTCCGCGATGGTTTCCTCG TGG Intergenic
No off target data available for this crispr