ID: 1175215905

View in Genome Browser
Species Human (GRCh38)
Location 20:57391607-57391629
Sequence CCCCGAGCGCGGGCTTCCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175215898_1175215905 4 Left 1175215898 20:57391580-57391602 CCATGCTGCTGCAGCCCGCGCCG 0: 1
1: 0
2: 5
3: 21
4: 209
Right 1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 102
1175215894_1175215905 8 Left 1175215894 20:57391576-57391598 CCCCCCATGCTGCTGCAGCCCGC 0: 1
1: 0
2: 1
3: 14
4: 294
Right 1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 102
1175215897_1175215905 5 Left 1175215897 20:57391579-57391601 CCCATGCTGCTGCAGCCCGCGCC 0: 1
1: 0
2: 0
3: 27
4: 181
Right 1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 102
1175215895_1175215905 7 Left 1175215895 20:57391577-57391599 CCCCCATGCTGCTGCAGCCCGCG 0: 1
1: 0
2: 0
3: 15
4: 180
Right 1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 102
1175215899_1175215905 -10 Left 1175215899 20:57391594-57391616 CCCGCGCCGTGCGCCCCGAGCGC 0: 1
1: 0
2: 3
3: 25
4: 239
Right 1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 102
1175215896_1175215905 6 Left 1175215896 20:57391578-57391600 CCCCATGCTGCTGCAGCCCGCGC 0: 1
1: 0
2: 0
3: 21
4: 222
Right 1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 102
1175215893_1175215905 25 Left 1175215893 20:57391559-57391581 CCGTAGGCGGCGGGGCGCCCCCC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG 0: 1
1: 0
2: 1
3: 13
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175215905 Original CRISPR CCCCGAGCGCGGGCTTCCCG CGG Exonic
901063779 1:6485531-6485553 CGCCGAGCGCGGGGACCCCGGGG + Intronic
904045191 1:27604294-27604316 CCCCAGGCGCGGGGTCCCCGGGG - Intronic
904773317 1:32893102-32893124 CACCGAGCGCGGGCCGCCCTGGG + Intronic
906640553 1:47438379-47438401 CCCCGCGCTCTGGCGTCCCGGGG + Exonic
912793558 1:112675465-112675487 GCCCGAGCGCGGGCTTTACAGGG + Intronic
916667052 1:166975788-166975810 TCCCGAGCGCGGGCGTCCCTGGG - Intronic
920674928 1:208032047-208032069 CCCCGGGTCCGGGCTTCCCATGG + Intronic
920912881 1:210233804-210233826 CCGCAACCGCGGGCTTCCAGCGG + Intronic
921604351 1:217137468-217137490 CCCCAGGCGCGGTCTTCGCGGGG - Intronic
922205740 1:223444439-223444461 CCCCACGCGCGGGCCTCCAGGGG + Intergenic
922603043 1:226871154-226871176 CCCCGCGCGCCTCCTTCCCGGGG - Intronic
923630945 1:235649428-235649450 ACCCGCGCGCGGGCTTCCCCGGG + Intronic
1062937326 10:1398262-1398284 TCCCGAGTGCAGGCTTCCTGGGG + Intronic
1065883718 10:30059189-30059211 CTCGGAGCGCGGGGGTCCCGGGG - Intronic
1066979170 10:42396004-42396026 CCCCCACCGCGAGCTTCCCAAGG + Intergenic
1069744317 10:70705374-70705396 GCCCGAGCTCGGGCTCTCCGTGG + Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1070570725 10:77637963-77637985 CCCCGGGCGCGGGCGGCCCGCGG - Intronic
1071522043 10:86337456-86337478 CCCCGAGTGCTGGCTTTCTGTGG - Intronic
1075484862 10:122813953-122813975 CCCCCAGCCCTGGCCTCCCGTGG - Intergenic
1076035282 10:127195239-127195261 CCCCGACCCCGGGCTGCCCGCGG + Intronic
1077065668 11:640041-640063 CCCCGCGCCCGGCCTTCCCCGGG + Exonic
1077253851 11:1572064-1572086 GCCCGAGCGAGCGCTCCCCGCGG - Intergenic
1077532081 11:3102063-3102085 CCCCGAGGGCCGGCTTCCAGGGG - Intronic
1078090746 11:8263112-8263134 CCCCGGGCGCGTGCAGCCCGGGG + Intronic
1079353454 11:19712616-19712638 CCCCGGCCGCGCGCCTCCCGGGG - Intronic
1079451196 11:20601230-20601252 CCCGGAGCAGGAGCTTCCCGCGG + Exonic
1083221983 11:61258694-61258716 CCCCCAGTGGGGGCTTCTCGGGG - Exonic
1083747796 11:64745065-64745087 CCCCGAGGGCGGGCGACCGGAGG + Intronic
1084000137 11:66291727-66291749 CGCCCAGCGGGGGCTTCTCGGGG + Intergenic
1084024385 11:66438703-66438725 CGCCGACCTCGGGCTTCCTGAGG + Exonic
1084174369 11:67415839-67415861 CCCCGGGCGCCCGCTCCCCGCGG + Intronic
1088893139 11:114059924-114059946 CCGCGCGCCGGGGCTTCCCGGGG + Intronic
1089243062 11:117098246-117098268 CCCCCAGCCCCGGCCTCCCGCGG - Exonic
1090199902 11:124846467-124846489 CCCCGAGCCCAGCCTCCCCGGGG + Intergenic
1091718534 12:2795886-2795908 CCCCGCGCCCGGCCTCCCCGGGG - Intronic
1099955748 12:89351610-89351632 CCCCGCGCGCGGAGTTCCCTGGG + Intronic
1102961157 12:117094117-117094139 GCCCGAGCGAAGGCGTCCCGGGG - Intronic
1102997344 12:117360813-117360835 CCCCCAGCCCGGGCTGCCCGCGG + Intronic
1103433060 12:120904229-120904251 GCCCGAGCGCGGCGCTCCCGCGG - Exonic
1103883213 12:124182495-124182517 CCCAGGGCGAGGGCTTCCCGAGG - Intronic
1107078231 13:36346362-36346384 CCTCGCGCGCGCGCTTGCCGTGG + Intronic
1113683326 13:112260450-112260472 CCACGAGCTCGTGCTTCCCGTGG - Intergenic
1113711278 13:112466923-112466945 CCCCCATCCCGGGCTCCCCGGGG + Intergenic
1113896573 13:113768441-113768463 CCCAGAGCTGGGGCTTCCTGTGG + Intronic
1114633075 14:24172051-24172073 CCCGAAGCGCTCGCTTCCCGCGG + Exonic
1116849366 14:49893123-49893145 CCCCGAGCGCGGGCTCCCTCCGG - Exonic
1117353329 14:54901976-54901998 CGCCCAGCGCGGGATTCTCGGGG - Intronic
1118808928 14:69260060-69260082 CCCCGAGCGCGCGCGTCCCCCGG - Exonic
1119383019 14:74240504-74240526 CCCCGAGCCCGCGCGTCCCCGGG - Intronic
1121105702 14:91278109-91278131 CCCGGTGTGCTGGCTTCCCGGGG + Exonic
1121121687 14:91379754-91379776 CCCCGTGCCCGGGCCTCCTGCGG + Intronic
1123055431 14:105567050-105567072 CCCTGAGCGCGGGCTCTGCGGGG + Intergenic
1123450555 15:20357064-20357086 CCCCCATCACGGGCCTCCCGTGG - Intergenic
1131200003 15:90388244-90388266 CCAAGTGCGCGGGCTTGCCGGGG - Exonic
1132559934 16:589046-589068 CCCGGACCGCGCTCTTCCCGGGG - Intergenic
1132731129 16:1362530-1362552 CCCCGAGCGCACGCTTACCTGGG - Exonic
1133079166 16:3305162-3305184 CCGCGTTCTCGGGCTTCCCGCGG - Intronic
1133117972 16:3589141-3589163 CCTCGGGCGCGGGCTCCCTGGGG - Exonic
1136365269 16:29806627-29806649 CCCCGAGCCCGGGCCCCGCGCGG + Exonic
1137555046 16:49465130-49465152 GCCTGAGCGCGGGGTTCCCTCGG + Intergenic
1138105868 16:54286928-54286950 CCCCGCGCGCGGGATCCGCGGGG - Intergenic
1139853787 16:69965468-69965490 ACCCGGGCGCGCGCTGCCCGAGG + Intergenic
1142129769 16:88427358-88427380 CCATGAGCGCAGGCTTCCCTGGG + Intergenic
1142501576 17:336092-336114 CACCGAGCCGGTGCTTCCCGAGG + Intronic
1147192756 17:38747414-38747436 CCCAGCGCCCGGGCTTCCCCAGG + Intronic
1151816416 17:76473585-76473607 CCCCGAGCTGCGGCTTCCTGTGG - Intronic
1152197128 17:78924634-78924656 CCCCCAGCGCTGGCATCCCAGGG + Intronic
1152468004 17:80476529-80476551 CCCAGAGCGCGGGCCGCTCGCGG - Exonic
1155910313 18:31498109-31498131 CCCCGAGGGCTGTCTTCCCGTGG - Exonic
1161797008 19:6393070-6393092 CACCGAGCGGCGGCTTCCCCGGG - Exonic
1163172314 19:15540748-15540770 TCCCGAGGGCTGGCCTCCCGAGG + Intronic
1167517391 19:49930988-49931010 CCTGGAGGGCGGGCTTCCAGTGG + Exonic
1168459173 19:56539146-56539168 CCTTGAGCGCGGCCTTCCCCGGG - Exonic
1168641411 19:58034142-58034164 CACCGCGCGCGGGCTTCGCTCGG - Exonic
931868934 2:66439389-66439411 CCCCGAGCCTGGGCTTCGCGCGG + Intronic
945235383 2:207627246-207627268 CCCCGGGAGCCTGCTTCCCGCGG + Intergenic
947846958 2:233252058-233252080 TCCCAAGCGCGGGTTACCCGGGG - Intronic
947992248 2:234497001-234497023 CCCGGAGCGCGGGCTTCCCCGGG + Exonic
948402003 2:237691744-237691766 CCCGGAGCGCCCGCTTCCCACGG + Intronic
1175215905 20:57391607-57391629 CCCCGAGCGCGGGCTTCCCGCGG + Exonic
1175730588 20:61351083-61351105 CCTTGAGCACGGGCTGCCCGGGG - Intronic
1176086253 20:63296857-63296879 CCCCGAGCCCCAGCTTTCCGGGG + Intronic
1178534841 21:33403181-33403203 CCCCGAAGGTGGGCGTCCCGCGG + Exonic
1179225067 21:39445776-39445798 CCCCGCGCGCGGGTTTCCATGGG - Intronic
1179626921 21:42654029-42654051 CCCCACGCGCCGGCTCCCCGGGG + Intronic
1179833294 21:44012001-44012023 CCCGCAGCTCGGGCGTCCCGCGG - Intergenic
1184265566 22:43344050-43344072 CCCCGTGCGGGGGCCTCCCGCGG - Intergenic
1185409625 22:50674864-50674886 CCCAGGGGCCGGGCTTCCCGGGG - Intergenic
955687582 3:61562154-61562176 CGCCGAGCGCGGGGGGCCCGTGG + Exonic
966712008 3:182980693-182980715 CCCCGGGCGCGGGGGTCCCCCGG + Intronic
968606021 4:1536152-1536174 CCCAGAGCGGGGGCTCCCCAGGG + Intergenic
969714408 4:8861345-8861367 CCCGGAGGCCGCGCTTCCCGCGG + Intronic
981475295 4:145180842-145180864 CCCGGCGCGCGCGATTCCCGCGG - Intergenic
985935242 5:3092513-3092535 GCCCCAGAGCAGGCTTCCCGTGG + Intergenic
998426986 5:142037074-142037096 CGCCGACCTCGGGCTTCCTGAGG + Intergenic
1001939420 5:175729949-175729971 CCCCGTGCCTGGGCTTCCCCTGG - Intergenic
1006012442 6:31054178-31054200 CCCGGAGCTCTGGCTTCCCTCGG + Intergenic
1008685599 6:53922892-53922914 CCCCGCGCGCCATCTTCCCGTGG + Exonic
1018869416 6:167769929-167769951 CCCAGAGCTCGGTCTTCCCATGG + Intergenic
1019053415 6:169201927-169201949 CCTCCAGCGCAGGCCTCCCGCGG + Intergenic
1020242935 7:6409565-6409587 CCACGGGCCAGGGCTTCCCGAGG + Exonic
1022050910 7:26670459-26670481 CCCCGAGAGAAGGCTTCCTGAGG - Intronic
1029614006 7:101644995-101645017 CCCACAGCGCGGGCACCCCGAGG - Intergenic
1032298770 7:130668324-130668346 CCCTGCGCGCGGGCCTCCGGCGG - Intronic
1034439815 7:151080901-151080923 CGCCGGGCGCGCACTTCCCGCGG - Intergenic
1042560496 8:70069912-70069934 CACCGCGCGGGAGCTTCCCGGGG + Intronic
1043969610 8:86514784-86514806 CCCCGAGCCCGGGCTCCTCCAGG - Intronic
1049557607 8:143290980-143291002 TCCCGAGCGTGGGCTTCCTTGGG - Intronic
1049611089 8:143555653-143555675 CCCAGGGCGCTGGCTTCCAGGGG + Intronic
1049785303 8:144448003-144448025 ACTGGAGCACGGGCTTCCCGTGG - Intergenic
1049804601 8:144533190-144533212 CCCCGAGCGCCAGCTGCCCTGGG - Exonic
1051896557 9:21994715-21994737 CCCTCAGCGCGGGCGCCCCGCGG + Intronic
1053149262 9:35732430-35732452 CCCCGAGGGCGGGGGTTCCGGGG - Exonic
1061015780 9:127980337-127980359 CTCCGAGCCCCGGCTCCCCGAGG - Exonic
1061860343 9:133464750-133464772 TCCCCAGCGTGGGCTTCCCCTGG + Intronic
1193533820 X:82688285-82688307 CCCCGAGTAAAGGCTTCCCGAGG + Intergenic