ID: 1175216891

View in Genome Browser
Species Human (GRCh38)
Location 20:57395902-57395924
Sequence CTGAGGGCATGGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 841
Summary {0: 1, 1: 1, 2: 5, 3: 89, 4: 745}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175216880_1175216891 18 Left 1175216880 20:57395861-57395883 CCAGTTTTGTCGGCCTTGGGCTG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG 0: 1
1: 1
2: 5
3: 89
4: 745
1175216882_1175216891 5 Left 1175216882 20:57395874-57395896 CCTTGGGCTGGCAGCGACTTGCT 0: 1
1: 0
2: 0
3: 7
4: 146
Right 1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG 0: 1
1: 1
2: 5
3: 89
4: 745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175216891 Original CRISPR CTGAGGGCATGGAGGGAGGT GGG Intronic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900356494 1:2267555-2267577 CTGAGGGCACTGAGGGAGTGGGG + Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900631768 1:3640261-3640283 CTGAGGCCAAGGAGGGCGCTGGG + Intronic
901051291 1:6427010-6427032 AAGAGGGCACGGAGGGAGCTGGG - Intronic
901570059 1:10152919-10152941 ATGAGGGCTTGGACGGAGCTAGG + Intronic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902188896 1:14746640-14746662 CTGGGGTCAGGGAGGGAGGGTGG + Intronic
902226023 1:14996876-14996898 GTGAGGTCAGGCAGGGAGGTGGG - Intronic
902283039 1:15388320-15388342 GGGAGGGGAGGGAGGGAGGTGGG - Intronic
902564972 1:17305505-17305527 CTGAGGGAAGGGCGGGGGGTGGG - Intergenic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903839083 1:26225498-26225520 CTTGGGGCGGGGAGGGAGGTGGG + Intergenic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904206185 1:28856760-28856782 CAGAGAGCATGGAGGGATGCTGG + Intronic
904597408 1:31655571-31655593 CTGGGGGCCTGGTGGGAGGGTGG - Intronic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
904807478 1:33142123-33142145 CAGAGGGCTAGGAGGGAGGTGGG - Intergenic
904989752 1:34582602-34582624 CTGAGGGAAGGGAGGGATTTAGG + Intergenic
905371303 1:37483927-37483949 CAGAGGGTGGGGAGGGAGGTGGG + Exonic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905788481 1:40776614-40776636 CTCAGGGATTGGAGGGAGGCCGG - Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
906996272 1:50797459-50797481 GTGAGGCCATGGTGGGAGGATGG + Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907193800 1:52669962-52669984 ATGATGGCATGGAGGAATGTTGG - Intergenic
907272334 1:53298342-53298364 CTGAGGGGCTGGGAGGAGGTGGG + Intronic
907283844 1:53367939-53367961 CAGAGGGCATGGGGGCAGGCAGG - Intergenic
908389108 1:63669469-63669491 CTGGGGGCATTGAAGGAGGGCGG - Intergenic
909344666 1:74571702-74571724 ATGAGGGCATGGGAGGAGGAAGG - Exonic
909524774 1:76610540-76610562 ATGAAGGCCTGGAGGGAGGGAGG + Intronic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
912498991 1:110109436-110109458 ATGGTTGCATGGAGGGAGGTGGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
912990582 1:114482460-114482482 ATGAGTGCAGGGAGGGAGATGGG + Intronic
913186486 1:116373956-116373978 CTCAGGGCACGGAGGGCGGAGGG - Exonic
915030014 1:152871089-152871111 CTGAGGCCATGGAGGGGCTTTGG + Intergenic
915267508 1:154729402-154729424 CCGAGTGCATGGAGAGAGGGTGG + Intronic
915282821 1:154834272-154834294 CTGAGAGCCTGGAGGAAGGCTGG + Intronic
915972324 1:160363373-160363395 TTGAGGGAGGGGAGGGAGGTTGG - Intergenic
916463915 1:165054153-165054175 GTGAGGGTAGGGAGGGAGTTGGG - Intergenic
916499812 1:165376812-165376834 CTGAAGGCAGGGAGGTAGGGAGG - Intergenic
916521844 1:165570356-165570378 TTGAGGAAATGTAGGGAGGTGGG - Intergenic
916962994 1:169907907-169907929 CTGAGGGCATGTAGGTGGGAAGG - Intergenic
917477741 1:175383473-175383495 CTGAGGGCAGGGAGGGGTTTTGG + Intronic
917709290 1:177668327-177668349 CTAAGGGGATACAGGGAGGTTGG + Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
918234677 1:182569356-182569378 TTGAGGGAAAGGAGGGAGGGGGG - Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
920185101 1:204154589-204154611 CTGAGGGACTAGAGGGAGCTTGG + Intergenic
920370943 1:205478955-205478977 GGGAGGGCAGGGAGGGAGGAGGG + Intergenic
920498803 1:206473394-206473416 CAGTGGGCATTGAGGGTGGTGGG + Intronic
920747926 1:208646478-208646500 AGGAGGGCAGGGAGGGAGGGAGG - Intergenic
921177237 1:212606205-212606227 CTGAGGGGAGGGAGGCAGGCAGG + Intronic
922178064 1:223212531-223212553 CTGATGGCTTGGTGGGAGGTGGG + Intergenic
922978619 1:229805764-229805786 CTAAGTGCTTGGAGGGAGGAGGG + Intergenic
923012185 1:230096625-230096647 ATGGGAGCAGGGAGGGAGGTTGG - Intronic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923120970 1:230991041-230991063 CTGAGTGCATGCAGGGAATTTGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923750084 1:236739493-236739515 CGGAGGGCATGAAGGCAGGACGG - Exonic
1062983045 10:1741704-1741726 CAAAGGGCATGGAAGGAGGCTGG + Intergenic
1063049446 10:2430861-2430883 CGGAGGGAAGGGAGGGAGGGAGG + Intergenic
1063428331 10:5966609-5966631 CTGAGGGCTTGGAGAGGGGTGGG - Intronic
1063542784 10:6950951-6950973 CTATGGGCAGGGAGGGAGCTGGG + Intergenic
1064017534 10:11784122-11784144 CTCAGGGCCTGAGGGGAGGTCGG - Intergenic
1065139135 10:22703562-22703584 ATGAGGGCAAGGAGGAAAGTGGG + Intronic
1065501787 10:26390530-26390552 CGGAGGGGATGAAGAGAGGTTGG + Intergenic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1066306088 10:34142582-34142604 CGGGGGGCAGGGAGGGAGGGAGG + Intronic
1066663702 10:37761275-37761297 CTTAGGTCATGAAGGCAGGTTGG + Intergenic
1067102310 10:43342423-43342445 TGGAGGGCAGGGAGGGAGGGAGG + Intergenic
1067270516 10:44787815-44787837 CTCTGGGCATGGAGGAAGGTAGG - Intergenic
1067345987 10:45439590-45439612 CTGCTGGCATGGAGGGACCTGGG + Intronic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1068777301 10:60881834-60881856 TTGAGGGCATTGAGGGTGTTTGG - Intronic
1068830250 10:61485817-61485839 GTGAGGGCATAGAGGGATGCTGG - Intergenic
1069629816 10:69890595-69890617 GCCAGGGCATGGAGGGAGGCAGG + Intronic
1069637760 10:69936062-69936084 GTGAGGGAAGGGAGGGAGGGAGG + Intronic
1069642099 10:69962732-69962754 CTGAGAGGAGGGAGGGAGGTGGG - Intronic
1069754407 10:70764343-70764365 CTGAAGGCTTGGGGGAAGGTAGG + Intergenic
1069900165 10:71702370-71702392 CTGAGGGAACGGAGGGAGCTGGG + Intronic
1069917054 10:71793661-71793683 CTGGGAGCTGGGAGGGAGGTGGG - Intronic
1070148804 10:73792853-73792875 GTGAGGGGATGGAAGGAGGGAGG + Intronic
1070328646 10:75403315-75403337 CTGCGGGGATGGCGGCAGGTGGG - Intergenic
1070763237 10:79038907-79038929 ATGTGGCCATGGTGGGAGGTGGG + Intergenic
1070976304 10:80608684-80608706 CTGAAGGCACGGAGGGCGGGAGG - Intronic
1071161322 10:82749093-82749115 TTGAGGGCTTGGAGAGAGGAGGG + Intronic
1071484226 10:86087782-86087804 TTGCGGGCTGGGAGGGAGGTGGG - Intronic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1072805070 10:98418948-98418970 CTGAGGGCACGGAGGAAAGCTGG + Intronic
1073037690 10:100575723-100575745 CTGATGGCATGGAGAGAGGGCGG - Intergenic
1073391019 10:103176343-103176365 GTGGGGACAGGGAGGGAGGTAGG - Intronic
1074104088 10:110376026-110376048 GCGAGGGCATGGATGGAGGAGGG - Intergenic
1074210699 10:111331537-111331559 CTGAGGAGATGGAGGGAGACAGG - Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074638294 10:115346266-115346288 CTTAGGGTCTGGAAGGAGGTGGG - Intronic
1074850618 10:117436730-117436752 AAGATGGCATGGAGGGAGCTGGG - Intergenic
1075182249 10:120222141-120222163 CTGTGGGCATGGCAGGAGCTGGG - Intergenic
1075605190 10:123800088-123800110 CTGAGGGCAAGCAGGCAAGTAGG - Intronic
1076043922 10:127275429-127275451 AGGAAGGCATGGAAGGAGGTAGG + Intronic
1076216306 10:128696271-128696293 CTGAGGGCATGGAGGGCTGTGGG - Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076471533 10:130722115-130722137 CTGAAGGCAAGGATGGAGGGAGG + Intergenic
1076882389 10:133245844-133245866 CTGCGGGCTGTGAGGGAGGTGGG + Intergenic
1076977924 11:189542-189564 CTGTGGGTTTGGGGGGAGGTGGG + Intronic
1077546101 11:3170708-3170730 CTGGAGGCAAGGAGGGAGGTTGG + Intergenic
1077556792 11:3229911-3229933 GGGAGGGGATGGAGGGAGGCTGG - Intronic
1077591264 11:3492634-3492656 ATGGGGGCATGGAGCTAGGTGGG + Intergenic
1078228107 11:9411871-9411893 TTCAGGGTATTGAGGGAGGTAGG + Intronic
1078473393 11:11609897-11609919 CTCAGGGCATGGGGTGGGGTAGG - Intronic
1078528359 11:12117884-12117906 CTGAGGGTCTGGAAAGAGGTTGG - Intronic
1078913082 11:15751455-15751477 CTGGGGGCATGTAGAAAGGTTGG - Intergenic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1081872677 11:46390726-46390748 CTAGGGGCTTGGAGGGAGGGCGG - Intergenic
1082114191 11:48309941-48309963 CTGAGAACTTGGATGGAGGTGGG - Intergenic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083201990 11:61126226-61126248 CAGAGGTGATGCAGGGAGGTCGG - Intronic
1083261856 11:61527522-61527544 AGGAGGGCAGGGAGGGAGGGAGG - Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083681595 11:64354144-64354166 CTGAGGGCAGGGAGGCAGATGGG + Exonic
1083744415 11:64727238-64727260 CTGAGGGCTGGGGGGGAGCTGGG - Intronic
1084033741 11:66495540-66495562 CTGGGGGCGTGGAGGGTGGGTGG + Intronic
1084043854 11:66557890-66557912 CGGAGGGCATGAAGGCAGGCCGG - Exonic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084215993 11:67647115-67647137 CTCAGGGCAAGGATGGCGGTGGG + Intronic
1084246965 11:67864385-67864407 ATGGGGGCATGGAGCTAGGTGGG + Intergenic
1084507016 11:69574725-69574747 CTGAGTGGATGGTGGGAGGGAGG - Intergenic
1084739926 11:71133133-71133155 ATGAGTGGATGGAGGGAGGGAGG + Intronic
1084825724 11:71730146-71730168 ATGGGGGCATGGAGCTAGGTGGG - Intergenic
1084911022 11:72389312-72389334 CTGATGGCACAGAGGAAGGTAGG + Intronic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085342607 11:75743233-75743255 CTCACAGCCTGGAGGGAGGTTGG - Intergenic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1086112288 11:83212721-83212743 ATGAGGCCATGCAGGTAGGTAGG - Intronic
1086209187 11:84297721-84297743 CTGGGGGCATGGAAGGAAGTCGG - Intronic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087749638 11:101993203-101993225 TTGAGGCCATGGAGGGTGGGAGG - Intronic
1088545142 11:110951634-110951656 GTGAATGCATGGAGGGAGGGTGG + Intergenic
1088824599 11:113483216-113483238 CTGGGGGCATGGAGGGACACAGG - Intergenic
1088928759 11:114328071-114328093 CTGAGGGTGGGGAAGGAGGTTGG - Intergenic
1089011086 11:115132391-115132413 CTTGGGGGATGGAGGGAGTTGGG + Intergenic
1089275969 11:117336384-117336406 CGGTGGGTATGGAGGAAGGTGGG + Intronic
1089350045 11:117816995-117817017 CTGTGGGCATGGGGGCAGGAGGG - Intronic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1089461785 11:118658180-118658202 CTGAGGACAGGCTGGGAGGTAGG + Exonic
1090175703 11:124647564-124647586 CTCAGGGCATGGATGGAGGGAGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1091714923 12:2770231-2770253 CTGCAGGCATGGAGGGCAGTGGG - Intergenic
1092049964 12:5461595-5461617 ATGAGGACATGGCGGGAGGGTGG - Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092937662 12:13379123-13379145 CAGAGGAAATGCAGGGAGGTGGG - Intronic
1093288378 12:17294672-17294694 ATGAGGGTAGGGAAGGAGGTAGG - Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094668613 12:32546646-32546668 CATAGAGCATGGAGGGAAGTAGG + Intronic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1095364676 12:41388243-41388265 ATTAGAGCATGGAGGGTGGTTGG + Intronic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1095975127 12:47935140-47935162 CTGAGGGCACGGGGGCAGGAGGG + Intronic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096474348 12:51899076-51899098 ATGATGGCATGGAGGTGGGTGGG - Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096532210 12:52249219-52249241 CTCTGGGCATGGGGGGAGGGAGG - Intronic
1096618020 12:52845362-52845384 CTGAGGAAATGCAGGAAGGTCGG - Intronic
1096716106 12:53492744-53492766 GTGGGGGCGGGGAGGGAGGTTGG - Intronic
1096861591 12:54532639-54532661 CTGAGGGCAGGCAGGGTGGGTGG - Intronic
1097269597 12:57765908-57765930 CTGGGGGCATGGTGGGAGGTCGG - Intronic
1099158196 12:79206628-79206650 CTGAGAGCATTGAGTGATGTGGG - Intronic
1100065707 12:90641473-90641495 AGGAAGGCATGGAGGGAGGGAGG + Intergenic
1100387212 12:94114680-94114702 CTGTAAGCATGCAGGGAGGTGGG - Intergenic
1100421837 12:94442360-94442382 CTGGGGGGAAGGAGGGAGGGGGG + Intronic
1100644714 12:96516547-96516569 CTTAGGGAATAGAGGGCGGTCGG + Intronic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1101176339 12:102155582-102155604 CTGAGAGCATGGTGGGGGGGGGG + Intronic
1101693559 12:107103401-107103423 CTGAGGGCAATGAGGGAGGGAGG - Intergenic
1101736654 12:107468291-107468313 CTGTGGGCCTGGCAGGAGGTAGG + Intronic
1101925181 12:108965954-108965976 GGGAGGGAATGGAGGGAGGGAGG - Intronic
1102155543 12:110724651-110724673 CTGCTGTCATGGAGGTAGGTGGG - Exonic
1102431051 12:112883059-112883081 CTTAGTGCATGGAGGGAGAGGGG + Intronic
1102491335 12:113291207-113291229 CTGGGGACATGCAGGGAGATGGG - Intronic
1102636730 12:114331179-114331201 TTGAGGGAATGGAGGCAGGGAGG + Intergenic
1102648226 12:114417793-114417815 CTGAGGACATGGCTGGAGATGGG - Intergenic
1102912562 12:116728760-116728782 CTGTGGGCCTTGAGGGAGTTGGG - Intronic
1103331839 12:120159733-120159755 CTGAGTGCTTGTGGGGAGGTGGG - Intronic
1103528115 12:121580709-121580731 ATGAGGGCAGGAACGGAGGTGGG - Intronic
1103966244 12:124641722-124641744 CTCTGGGCAAGGAGGGAGCTAGG - Intergenic
1103988928 12:124785343-124785365 GTGAGGGCAGGGACAGAGGTAGG - Intronic
1104310964 12:127654015-127654037 CGAAGGTCATGGAGGAAGGTGGG - Intergenic
1104503643 12:129310202-129310224 GTGAGGGCAAGGAGGGTGGGTGG + Intronic
1104731054 12:131105559-131105581 GTGTGGGCATGGAAGGAGCTGGG + Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1104916422 12:132267189-132267211 ATGAGGGCAGGGAAGGAGGCAGG + Intronic
1104928405 12:132325664-132325686 CTGAGAGCCTGGAGCGGGGTGGG - Intronic
1105378376 13:19864284-19864306 CTGCAGCCATGGCGGGAGGTGGG - Intergenic
1105388838 13:19958064-19958086 CTGCAGCCATGGCGGGAGGTGGG + Intergenic
1106013130 13:25843923-25843945 CTCAGGGCAGGGTTGGAGGTAGG + Intronic
1106020012 13:25905594-25905616 CAGAGGGCATGGAGAGGGGCCGG - Intronic
1107404553 13:40100270-40100292 CTGAGGAGATTGAGGGATGTGGG - Intergenic
1108001704 13:45910445-45910467 CTGAGGGCATCCAAGGAAGTGGG - Intergenic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108645333 13:52421380-52421402 AGGAGGGGATGGAGAGAGGTTGG + Intronic
1108703133 13:52960468-52960490 CTGAGGGGTTTGAGGGGGGTGGG + Intergenic
1108845892 13:54678231-54678253 CTGAGGGGTTGGAGAGAGGGAGG - Intergenic
1110022681 13:70494738-70494760 TTAAGGGCAGGGAGGGAGATAGG - Intergenic
1111630004 13:90838416-90838438 TTGAGGGCATGGGGGAAGGTGGG - Intergenic
1111908942 13:94288417-94288439 CTGGGGACATGGAGGGAGGTGGG - Intronic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1112728360 13:102330744-102330766 ATGAGGCCATGAAGGGAGGAGGG - Intronic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113695030 13:112339234-112339256 CTGAAGAGAAGGAGGGAGGTGGG - Intergenic
1114246890 14:20922537-20922559 GAGAGGGCATGGGGGCAGGTGGG - Intergenic
1114617734 14:24077131-24077153 CTGAGGGCAAGCAGAGAGGGTGG - Intronic
1115503843 14:34075278-34075300 CTGAGGGCTTGGGGGCAGGAGGG - Intronic
1115528913 14:34308049-34308071 GAGAGGTCATGGTGGGAGGTGGG - Intronic
1117389325 14:55247999-55248021 CTGTGGCCATAGAGGGTGGTAGG + Intergenic
1117582336 14:57164621-57164643 CTGAGGGCATGAAGAGAGGGTGG + Intergenic
1118099385 14:62579071-62579093 TGGGGGGCTTGGAGGGAGGTGGG + Intergenic
1118763001 14:68892070-68892092 CAGAGGGCATGAAGGCAGGCCGG + Exonic
1118961565 14:70538143-70538165 CTGAGGGCTTGGGGGCAGGGCGG - Intergenic
1119474336 14:74918526-74918548 CTGAGGGGCTGCAGGGTGGTCGG - Exonic
1120186904 14:81402776-81402798 CTGAAGGCAGGGAGACAGGTAGG - Intronic
1120666379 14:87311266-87311288 CGGGAGGCATGGAGGGAGGAAGG - Intergenic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121098398 14:91233628-91233650 GTGAGGACATGGAGGGTGGGAGG - Exonic
1121125717 14:91405410-91405432 CTGAGGGCTTGGAATGAAGTGGG - Intronic
1121240439 14:92426068-92426090 ATCAGGGCAGGGAGAGAGGTGGG + Intronic
1121727926 14:96166493-96166515 CTGAGGACCTGCAGGGAGGGTGG + Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122650783 14:103225534-103225556 CTGATGGCAAGGAGGGAATTTGG - Intergenic
1122737974 14:103854832-103854854 TGGAGGCTATGGAGGGAGGTAGG + Intergenic
1122793709 14:104195252-104195274 CTGGGGGCATGGGGTGAGGCAGG + Intergenic
1122874333 14:104656602-104656624 CTGAGGACGTGGAGGGCGGTGGG + Intergenic
1123035277 14:105469391-105469413 CTGAGGCCGTGGTGGGCGGTGGG + Intronic
1124184975 15:27517080-27517102 CTGGGCGCATGCATGGAGGTGGG - Intronic
1124867509 15:33507634-33507656 TTGAGGGCTTAGAGGGAGGTGGG - Intronic
1125756643 15:42069714-42069736 CAGAGGGCCTGCAGGGATGTGGG + Intronic
1126242398 15:46460200-46460222 CAGAGTGCTGGGAGGGAGGTGGG + Intergenic
1126326469 15:47483124-47483146 TTGGGGGCATGGAGGGAATTTGG + Intronic
1126785663 15:52176208-52176230 CTGAGAGCCTGGGGGAAGGTGGG - Intronic
1127068586 15:55265794-55265816 CTGAAGGGATGCATGGAGGTAGG + Intronic
1127776890 15:62270645-62270667 CACAGGGCAGGGAGGGAGGTGGG + Intergenic
1128801609 15:70500622-70500644 CTGATGCCAGGCAGGGAGGTGGG + Intergenic
1129416995 15:75389629-75389651 GTGAGGGCATGGAGGAGGCTAGG - Intronic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1129771967 15:78208314-78208336 CTTAGAGCCTGGAGGGAGGCTGG - Intronic
1129772907 15:78214063-78214085 CTGTGGGAATGGGGGGAGCTGGG - Intronic
1130006384 15:80103001-80103023 CTAAAGTCATGGATGGAGGTGGG - Intronic
1130159562 15:81385212-81385234 CTGCAGGCCTGAAGGGAGGTGGG + Intergenic
1131327315 15:91460710-91460732 ATGAGATCATGGAGTGAGGTGGG + Intergenic
1131361181 15:91792068-91792090 CAAAGGGGATGGAGGGAGGAGGG - Intergenic
1131510533 15:93047408-93047430 CTGAAGCCACGAAGGGAGGTGGG + Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132618247 16:852751-852773 CAGGGGGCATGGAGGGCTGTTGG + Intergenic
1132633907 16:933602-933624 CTGAGGTCATGGAGAAAGGCAGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133418014 16:5621514-5621536 TTGAGGAAATGGAGGGAGGGAGG + Intergenic
1133559872 16:6941225-6941247 GGGAGGGGATGGAGGGAGGGAGG - Intronic
1134098489 16:11435496-11435518 CTGAGGGCATGAAAAGAGGGTGG - Intronic
1134422784 16:14110394-14110416 CTGAAGGCAGTCAGGGAGGTAGG + Intronic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134508308 16:14825178-14825200 CTGCTGGAATGGAGGGTGGTGGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134696004 16:16223943-16223965 CTGCTGGAATGGAGGGTGGTGGG + Intergenic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134782416 16:16910188-16910210 GTGAGTGGATGGAGGGAGGTAGG + Intergenic
1134799683 16:17071956-17071978 CAGAAGGCAGGGAGGGAGGGAGG - Intergenic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134975821 16:18570745-18570767 CTGCTGGAATGGAGGGTGGTGGG - Intergenic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135048503 16:19173407-19173429 CTGAGGCCATTGGGGGAGGTGGG - Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135269596 16:21057668-21057690 CTGAAGGCAGGACGGGAGGTGGG + Intronic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1135861369 16:26058948-26058970 CTGGGGGCTGGGAGGAAGGTGGG + Intronic
1136004484 16:27319227-27319249 CAGAGGTCAGGGAGGGAGCTGGG + Intronic
1136289935 16:29265434-29265456 CCAAGGCCATGGAGGGAGGGAGG - Intergenic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136388108 16:29943050-29943072 GTTTGGGCATAGAGGGAGGTGGG + Intronic
1136721293 16:32321063-32321085 CTGAGGGCCTGGTGGCTGGTCGG - Intergenic
1136839676 16:33527349-33527371 CTGAGGGCCTGGTGGCTGGTCGG - Intergenic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1138369721 16:56517134-56517156 GTGACGGGATGTAGGGAGGTAGG - Intronic
1138502753 16:57458231-57458253 CTGAGGGCCTGGAGAGAGAATGG - Exonic
1138916959 16:61476281-61476303 CAGAGGCCAGGAAGGGAGGTAGG + Intergenic
1138983265 16:62296237-62296259 CTGAGTGAATTGAGGGATGTGGG - Intergenic
1139293563 16:65879364-65879386 CTGAATGCATGGATGGAGGGTGG + Intergenic
1139517533 16:67460661-67460683 CAGATGGCATGGGGGGAGGGGGG - Intronic
1139782604 16:69364298-69364320 CTCAGGGAAGGGAGGGAGGGAGG - Intronic
1139851499 16:69953373-69953395 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1139880475 16:70176285-70176307 CTGAGTGGATGCAGGGAGGGGGG - Intronic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1141595172 16:85092948-85092970 CTGAGGGCCTGTATGGAGGGCGG - Exonic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141854866 16:86674010-86674032 ATGAAGGGATGGAGGGGGGTTGG - Intergenic
1141946011 16:87310713-87310735 CTGGCTGCATGGAGGGAGGTGGG - Intronic
1142037305 16:87869875-87869897 CTGAGGCCAAGGATGGAGTTTGG + Intergenic
1203005139 16_KI270728v1_random:196707-196729 CTGAGGGCCTGGTGGCTGGTCGG + Intergenic
1203136689 16_KI270728v1_random:1732828-1732850 CTGAGGGCCTGGTGGCTGGTCGG + Intergenic
1203149842 16_KI270728v1_random:1827634-1827656 CTGAGGGCCTGGTGGCTGGTCGG - Intergenic
1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG + Intergenic
1142563649 17:825897-825919 CTAAGGGCATGGAGGAGGGAGGG + Intronic
1142589724 17:997411-997433 CTGAGGGCCTGGACGGCAGTGGG + Intronic
1142810373 17:2393166-2393188 CGTAGGGGATGGAGGGACGTGGG - Intronic
1142890450 17:2939681-2939703 CTCAGGGCAGGGATGGAGGGGGG + Intronic
1144671056 17:17132740-17132762 CTGGGGTCAGGGAGGCAGGTGGG + Intronic
1144959073 17:19034697-19034719 CAGAGGGCCTGAAAGGAGGTCGG - Intronic
1144976086 17:19139827-19139849 CAGAGGGCCTGAAAGGAGGTCGG + Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145957386 17:28863974-28863996 CTGAGGGAATGGGGTGAGGTGGG - Intergenic
1146674495 17:34763961-34763983 CCGAGGGCATGATGGGAGGATGG + Intergenic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1147626892 17:41906377-41906399 CAGAGGGCTTCGAGGGATGTTGG - Intronic
1147742977 17:42679255-42679277 CTGAGGGCCTGGGTGGGGGTGGG - Exonic
1148113674 17:45162169-45162191 CTGAGAGGAAGGAGGGAGGCAGG + Intronic
1148236329 17:45971676-45971698 GTGTTGGCAGGGAGGGAGGTGGG + Intronic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149680733 17:58505345-58505367 CTGAGGGCCTGGGTGGAGTTGGG - Intronic
1150626091 17:66842089-66842111 GTGAGGGCATGGTGGGCAGTGGG - Intronic
1151983679 17:77528735-77528757 GTGGGGGCATGGAGGGAGAGAGG + Intergenic
1152227658 17:79100062-79100084 ATCAGGGAATGGAGGGAGGTGGG - Intronic
1152423547 17:80206852-80206874 CTGAGGGCAGGGCAGGAGCTGGG - Intronic
1152469571 17:80483189-80483211 GGGAGGGCCTGGAGGGAGGGAGG + Intergenic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1152932139 17:83115457-83115479 CCGAGGGCATCGAAGGAGGCTGG - Intergenic
1153914337 18:9732509-9732531 GTGTGGGCATGCAGTGAGGTGGG + Intronic
1155046929 18:22110798-22110820 CTCAGGGCCTGCAGCGAGGTGGG - Intergenic
1155963987 18:32019085-32019107 CTGAGGGCATGGTGTGGGGAAGG + Intronic
1156041774 18:32831047-32831069 ATGAGGGCTCGGAGGGAGCTGGG + Intergenic
1156261063 18:35445344-35445366 TTGTGGGGAGGGAGGGAGGTGGG + Intronic
1156610596 18:38719347-38719369 CTAAGGACATAGAGTGAGGTGGG + Intergenic
1157147509 18:45179351-45179373 CTGAGGCCATGGTGGGAGAGAGG - Intergenic
1157280101 18:46341307-46341329 CTGAGGTCAGGGAGGGGGGTGGG + Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157828162 18:50831282-50831304 CAGAGGGCATGGAGAGAGATTGG - Intergenic
1159463173 18:68745719-68745741 CGGGAGGCATGAAGGGAGGTAGG - Intronic
1159899912 18:74036421-74036443 CTGATGGCAGGGATGGAGGCAGG - Intergenic
1160347888 18:78149855-78149877 CTGAGGAGAGGGAGGGAGATGGG + Intergenic
1160394673 18:78562980-78563002 CTCAGGGCAGCGAGGGGGGTCGG + Intergenic
1160460077 18:79032308-79032330 CTGAGAACATGCAGGGAGGAAGG - Intergenic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1160767888 19:816517-816539 CTGGGGGCATGGGTGGAGGATGG - Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161253288 19:3292972-3292994 CAGAGGGCTTGGAAGGAGGCAGG + Intronic
1161279052 19:3435190-3435212 CGGAGGACATGGAAGGAGGTAGG + Exonic
1161470505 19:4454756-4454778 CTTATGGCAGGGAGGGAGGGAGG - Intronic
1161489703 19:4555240-4555262 GTCAGGGCTTGGATGGAGGTGGG - Intronic
1161732450 19:5969699-5969721 CCGAGGCCATGGAAGCAGGTAGG - Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162341359 19:10093271-10093293 GTGAGGGAATGAAAGGAGGTAGG - Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162622518 19:11855297-11855319 CTGGGTCCATGGAGGGGGGTAGG + Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163648968 19:18506091-18506113 CCCAGGGCTTGGAGGGAGGCTGG - Intronic
1163795546 19:19335812-19335834 CACAGGGCATGTCGGGAGGTGGG - Intronic
1163871825 19:19828192-19828214 CATAGGGAATTGAGGGAGGTGGG - Intergenic
1164028717 19:21380486-21380508 CATAGGGAATTGAGGGAGGTGGG + Intergenic
1164309053 19:24030441-24030463 CTCAGGGCCTGGGGAGAGGTGGG + Intergenic
1164479800 19:28602612-28602634 CTGAGGAGTGGGAGGGAGGTGGG - Intergenic
1164564086 19:29313645-29313667 CTCAGGGGGTGGTGGGAGGTTGG - Intergenic
1164760227 19:30722978-30723000 CCCAGGGCCTGGAGGGTGGTGGG + Intergenic
1164861467 19:31565325-31565347 CTGAGCACATTGAGGCAGGTGGG - Intergenic
1165149848 19:33753932-33753954 GTGTGGGGATGGTGGGAGGTTGG - Intronic
1165305696 19:35001031-35001053 TTGAGGTCATGGAGGGCGGGGGG + Intronic
1165386317 19:35512536-35512558 ATGTGGGCTTGGAGGGAGGGAGG + Intronic
1165475213 19:36026465-36026487 CTGAGGAGATAGCGGGAGGTTGG - Intronic
1165843219 19:38801949-38801971 CTGAGGCCCTGGAAGGAAGTGGG + Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166699537 19:44874315-44874337 CTGAGGTCCTGGAGGGGTGTGGG - Exonic
1166756647 19:45196520-45196542 CTGAGGGAATTTAGGGAGATGGG + Intronic
1167245255 19:48369265-48369287 GGGAGGGCATGGAAGGAGTTTGG + Intronic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167468146 19:49660983-49661005 CTGATGGGAGGGAGGGAGGGAGG - Intronic
1167668985 19:50838959-50838981 CTGGGGGGTTTGAGGGAGGTAGG + Intergenic
1167748136 19:51364761-51364783 CAGGGGGCATTGAGGGAGATGGG + Intronic
1168272465 19:55257826-55257848 CTGAGGGCAGGCAGGGAGCCTGG - Intronic
1168277129 19:55284450-55284472 CCGGGGCCAAGGAGGGAGGTGGG + Exonic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925141324 2:1551441-1551463 CTGAGCACACGGAGGGCGGTGGG - Intergenic
925178519 2:1801163-1801185 TTGTGGGCATGGAGGGGGTTAGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
925848191 2:8052538-8052560 CTGAGGCCATGGTGGGTGGTTGG + Intergenic
925976529 2:9145987-9146009 AGGAGGGCATGGCGGAAGGTGGG - Intergenic
926148572 2:10411828-10411850 CTCAGGGCAAGGAGGTAGGCTGG + Intronic
926249095 2:11143417-11143439 CTGAGGGGCTGAAAGGAGGTGGG + Intronic
926272755 2:11378949-11378971 CACAGGGCAGGGAGTGAGGTGGG - Intergenic
926419929 2:12686188-12686210 CACAGAGCATGGAGGGCGGTGGG - Intergenic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926884185 2:17582225-17582247 GTGAGGGGAAGGAGGAAGGTGGG + Intronic
927087480 2:19686294-19686316 GGGAGGGGAGGGAGGGAGGTAGG + Intergenic
927688612 2:25191189-25191211 CTGAGGACAAGGTCGGAGGTTGG + Intergenic
928199953 2:29241469-29241491 CTTAGGGCCAGGAGGGAGATGGG + Intronic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929918480 2:46155475-46155497 CTGAGTGCAGGGTGGGAAGTGGG - Intronic
930000882 2:46860815-46860837 CTGAGGGCAGGGAGGCTGTTGGG + Intergenic
930032269 2:47065755-47065777 CTGAGGGCAGGGAGAGTGGGTGG - Intronic
930495334 2:52134578-52134600 CCCAGTGCAGGGAGGGAGGTGGG - Intergenic
931834608 2:66085583-66085605 CTGCGGGCTTTGAGGGAGCTGGG + Intergenic
932396155 2:71449932-71449954 CTAACAGAATGGAGGGAGGTTGG + Intergenic
932484542 2:72075696-72075718 CTGAGGGAATGCGGAGAGGTGGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932702441 2:74001120-74001142 CACAGGGCAGGGAGGGAGGCAGG - Intronic
932854630 2:75220360-75220382 AAGAGGGCATGGAGAGATGTTGG - Intergenic
934163334 2:89272617-89272639 CTCAGGGCACGCAGGGAGGGTGG + Intergenic
934713396 2:96529725-96529747 CTCTGGACATGGAGGTAGGTTGG - Intergenic
934735013 2:96685704-96685726 CCCAGGGCCTGCAGGGAGGTGGG - Intergenic
934764028 2:96870310-96870332 CACAGCGCCTGGAGGGAGGTGGG + Intronic
935341674 2:102064677-102064699 CTGAGAGCAAGGAGGCAGCTAGG - Intronic
936148618 2:109997939-109997961 CTGAGGGCCTGGTGGCTGGTCGG - Intergenic
936196060 2:110373429-110373451 CTGAGGGCCTGGTGGCTGGTCGG + Intergenic
936376006 2:111942072-111942094 GTGAAGGCCGGGAGGGAGGTGGG - Intronic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
936970339 2:118170730-118170752 CTGAGGAGATGGATGGAGATTGG - Intergenic
936978403 2:118241656-118241678 CTGGGGCCATGGAGGGTGGGTGG + Intergenic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
938104062 2:128518078-128518100 CATAGGGAATTGAGGGAGGTGGG + Intergenic
939144015 2:138390731-138390753 CAGATGGCGTGGAGGGAGGGCGG - Intergenic
939733849 2:145819312-145819334 AGGAGGGGATGGAGGGAGGAAGG - Intergenic
942270299 2:174267856-174267878 CTGAGGGAATTGAGGGGGCTGGG - Intergenic
944797241 2:203199812-203199834 GGGAGGGAATGGAGGGAGGAAGG - Intronic
945039237 2:205730345-205730367 TTGATGCCATGGGGGGAGGTGGG + Intronic
945170427 2:206989493-206989515 ATGGGGACAGGGAGGGAGGTGGG + Intergenic
945865941 2:215175768-215175790 GAGAGGGCATGAAGAGAGGTTGG - Intergenic
946163034 2:217847643-217847665 CTGAGGCCCTGGAGGGCTGTGGG + Exonic
946170623 2:217893155-217893177 CTCAGGGGAGGGAGGCAGGTGGG + Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946273830 2:218615806-218615828 CTCAGGGAAGGGAAGGAGGTTGG + Intronic
946427875 2:219609009-219609031 CTGAGAGCATGGAGGATGGCAGG - Intronic
946781486 2:223196355-223196377 CTGAGGGCATGAAGGTTGCTGGG + Intronic
947026225 2:225741012-225741034 GTGGGGCCATGGAGGGAGGCTGG - Intergenic
948408829 2:237743287-237743309 CAGAGGGGAGGGAGGGAGGGTGG + Intronic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
948929087 2:241119259-241119281 CGGAGGGTGGGGAGGGAGGTGGG + Intronic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1170539569 20:17374421-17374443 TTCAGGGCATGGAGGTGGGTGGG + Intronic
1171036986 20:21721956-21721978 CTGAGGTCAAGGTGGGAGGATGG - Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171530230 20:25848393-25848415 CTGGGGGCCTGCAGAGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1172649787 20:36494732-36494754 GGGAGGGCAAGGAGGGAAGTAGG - Intronic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1172958284 20:38778031-38778053 CAGAGGACATGGAGTGGGGTGGG + Intergenic
1173017986 20:39244135-39244157 CTGAGCACATGGAGGGCTGTGGG + Intergenic
1173026867 20:39315741-39315763 CTGAGAGGGTGCAGGGAGGTAGG - Intergenic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173549529 20:43923056-43923078 CTGGGGGCATGTAGAGTGGTGGG + Intronic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173971704 20:47158033-47158055 CACAGGGCATGGATGAAGGTAGG - Intronic
1173983312 20:47241544-47241566 GTGAGGGCAGGCAGGGAGGAGGG + Intronic
1174320187 20:49735606-49735628 CTGAGAGCATGGGGAGAGATGGG + Intergenic
1174548839 20:51346301-51346323 CAGAGGGCCAGGAGGCAGGTAGG + Intergenic
1174975528 20:55328853-55328875 CTGAGAAGATGGAGGGAGGGAGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175662044 20:60821827-60821849 GACAGGGCATGCAGGGAGGTGGG + Intergenic
1175886449 20:62293884-62293906 CTGAGGGCCTGGAGGGGCCTGGG + Exonic
1175903591 20:62369338-62369360 CTGAGCGTATGGAGGGCGGGGGG + Intergenic
1176212795 20:63933222-63933244 CTGAGGGCAATGAGTGAGCTGGG - Exonic
1176222608 20:63977186-63977208 AGGAGGGCAGGGACGGAGGTGGG + Intronic
1176411159 21:6450298-6450320 CTGAGGGCCTGGAGTGAGCACGG + Intergenic
1178088831 21:29140119-29140141 TTAAGGGCATGGTGGAAGGTGGG + Intronic
1178104133 21:29299278-29299300 CCGAGGGCAGGGAGGGGGGTGGG - Intronic
1178381637 21:32114701-32114723 CAGAGAGCAAGGAGGAAGGTGGG + Intergenic
1178418778 21:32426525-32426547 GTGAGTGCATGGAGGCTGGTGGG - Intronic
1178437200 21:32570377-32570399 CTGAGGGGAGGGAGAGAGATGGG - Intergenic
1178794030 21:35727001-35727023 CTGTGGGCAAGGAGGAGGGTAGG - Intronic
1178837581 21:36111750-36111772 GTGAAGGCAGGGAGGGAGGGAGG + Intergenic
1179182402 21:39057139-39057161 CTAAGGGCATGGGGGCAGGAGGG - Intergenic
1179625264 21:42645707-42645729 CTGAGGGCAAGGACCGAGGGAGG - Intergenic
1179686652 21:43058620-43058642 CTGAGGGCCTGGAGTGAGCACGG + Intronic
1179884328 21:44306997-44307019 CTGGGGGCAGGGAAGGAGCTGGG + Intronic
1180033503 21:45229013-45229035 CTGAGGGCATAGCGGGAGGTGGG - Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180133833 21:45847385-45847407 GTGAGGGTAAGGATGGAGGTGGG - Intronic
1180169178 21:46049076-46049098 TAGAGGGCATGGAGGGCGGTGGG - Intergenic
1180551479 22:16545245-16545267 CTGAGGGCCTGGTGGCTGGTCGG + Intergenic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181111346 22:20604798-20604820 CTGGCGGGAGGGAGGGAGGTTGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181542447 22:23580528-23580550 CTGAGGTCACACAGGGAGGTGGG + Intergenic
1181985267 22:26796272-26796294 CTCAGGGCCTGCAGGGAGCTTGG - Intergenic
1182064659 22:27421667-27421689 CTGAGGGCAGGAGTGGAGGTGGG - Intergenic
1182098924 22:27644603-27644625 CTGAGTGGATGGACGGAAGTAGG + Intergenic
1182112927 22:27735996-27736018 CAGAGGGCATGGAGGAAGCAAGG + Intergenic
1182411351 22:30189636-30189658 CTCAGGGCAAGGAGGGAGCAAGG - Intergenic
1182727084 22:32456447-32456469 ATGAGGGAAGGGAGGGAGGGAGG - Intronic
1182881781 22:33739839-33739861 ATGAGGGCATGGAAGGAGGCGGG + Intronic
1183167871 22:36161096-36161118 CTGATGGCATGGAGGGAGTGAGG - Intronic
1183281554 22:36935275-36935297 CTCAGGGCAGGGAGTGGGGTTGG - Intronic
1183327495 22:37202388-37202410 CTGAGGCCTTGGAGGGATGGTGG + Intergenic
1183445306 22:37849589-37849611 CTGAGGGCCGGGCGGGAGGTCGG - Intronic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183733486 22:39630970-39630992 CAGGGAGGATGGAGGGAGGTGGG + Intronic
1184111822 22:42399935-42399957 CTCAGAGCATGGAGCCAGGTAGG + Intronic
1184148595 22:42625688-42625710 CTGAGGTCACGGAGGAAGGTAGG + Intronic
1184636132 22:45833270-45833292 CTGAAGGCGTCGGGGGAGGTGGG + Intronic
1184810493 22:46828184-46828206 TTGAGAGAATGGATGGAGGTGGG + Intronic
1185294418 22:50046248-50046270 CTGAGGGCACCGAGGGCGGTGGG + Intronic
1203322947 22_KI270737v1_random:86267-86289 ATGAGGGAAGGGAGGGAGGGAGG - Intergenic
949342539 3:3045177-3045199 CAGAGGGCAAGGAGGCAGGCAGG - Intronic
949511222 3:4768779-4768801 GTGGGGGCGTGGAGGGAGCTCGG + Intronic
949812071 3:8016598-8016620 AACAGGGCAGGGAGGGAGGTGGG + Intergenic
949985437 3:9537179-9537201 CAGAGGAAATGGAGGGAGGCTGG - Intronic
950474442 3:13206706-13206728 CTGTGGGAAAGGAGGCAGGTGGG + Intergenic
950525482 3:13520507-13520529 CTGAGGGTCGGGAAGGAGGTGGG - Intergenic
950552448 3:13674997-13675019 CTGAGTGCAAGGAGTGAGGGAGG + Intergenic
951773807 3:26286469-26286491 TTCAGGCCATGGTGGGAGGTGGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
954479853 3:50788751-50788773 CTGAGGGCAAGGAGGGTGGCAGG + Intronic
954479862 3:50788779-50788801 CAGAGCGCAGGGAGGGAGGCAGG + Intronic
954578826 3:51692025-51692047 CTGGGGGAAGGGAGGGAGGTGGG - Intronic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954892426 3:53943416-53943438 CTGACGGGATGGAGAGAGCTTGG + Intergenic
955391393 3:58524773-58524795 CTGAGGGCCTCGAGGCAGGACGG - Intronic
955391685 3:58526659-58526681 GTGAGAACATGGAGGGGGGTTGG + Intronic
956321948 3:68007601-68007623 GGGAGGGGAGGGAGGGAGGTGGG - Intronic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
956603892 3:71052231-71052253 CTGAGGGCCAGGATGGAGCTGGG - Intronic
956747976 3:72324417-72324439 CTGAGTGAATGAAGGGATGTTGG - Intergenic
957368587 3:79259565-79259587 GTGGGGGCATAGGGGGAGGTGGG - Intronic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
958707462 3:97673751-97673773 CTGAGGGCATTGAGGAATGGAGG + Intronic
958767603 3:98388205-98388227 CTGAGGGCATTGTAGGATGTGGG + Intergenic
960046157 3:113200422-113200444 CTGAGGTCATGGAGTGGGGGTGG - Intergenic
960653685 3:119979439-119979461 CTGAAGGCTTGGAGGCAGGTAGG - Intronic
961010127 3:123430032-123430054 CTGAGGGCATGGGGGAATGGAGG - Intronic
961091664 3:124118089-124118111 CTGAGGGCTGGCATGGAGGTAGG + Intronic
961141855 3:124562789-124562811 AGGAGGGCATGGAGGAAGGGGGG - Intronic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961826482 3:129601817-129601839 CTGAGGGCTTGGAGGGTGGCAGG - Intronic
961895082 3:130160119-130160141 ATGGGGGCATGGAGCTAGGTGGG + Intergenic
964277926 3:155027476-155027498 CTGAGGGCAGGGAAGGTGGTTGG - Intronic
964484571 3:157174647-157174669 CAGAGGTCAAGCAGGGAGGTGGG + Intergenic
964938225 3:162121589-162121611 CAGAGGCCAGGAAGGGAGGTGGG - Intergenic
965224180 3:165966666-165966688 CTGAGGGGAGGGAGAGAGATGGG - Intergenic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967817941 3:193815000-193815022 CTTAGGACGTGGAGGGTGGTTGG - Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968649336 4:1754200-1754222 CTGGGGGCATGTGGGGAGGAGGG + Intergenic
969005180 4:4013176-4013198 ATGGGGGCATGGAGCTAGGTGGG + Intergenic
969207226 4:5655999-5656021 CTGAGGGAAGTGGGGGAGGTAGG + Intronic
969373103 4:6746649-6746671 GTGATGGCATGGATGGAGGGTGG + Intergenic
969517595 4:7656297-7656319 CTGAGGGCAGGGTGGGGGGCGGG - Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969529735 4:7724006-7724028 CCGAGGGCAGGGAGGCAGGGAGG + Intronic
969559882 4:7939978-7940000 CTGAGGGAACAAAGGGAGGTTGG + Exonic
969747684 4:9086975-9086997 ATGGGGGCATGGAGTTAGGTGGG - Intergenic
969875585 4:10133561-10133583 CAGAGGGCATGGATGGGGGTGGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
971503183 4:27338519-27338541 CATAGGGCAGGGAGGGAGGGAGG + Intergenic
972083366 4:35182320-35182342 CTGAGGCGATGGGGTGAGGTTGG - Intergenic
972383714 4:38543340-38543362 CTGAGGAGAAGGAGGGAGATGGG + Intergenic
972415713 4:38838595-38838617 GTGAGGGAATGAAGAGAGGTTGG + Intronic
972572911 4:40327107-40327129 CTGAGGGCAGGTGGGCAGGTGGG + Intergenic
973532435 4:51846145-51846167 TTTGGGGAATGGAGGGAGGTGGG - Intronic
973871974 4:55175940-55175962 CTGAGAGAATGGAGTCAGGTTGG + Intergenic
974859551 4:67502993-67503015 TTGAAGGGATGGAGGAAGGTTGG - Intronic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975264824 4:72350960-72350982 CTGAGAGCCTGGAGAGAGGAAGG - Intronic
975895365 4:79083793-79083815 CAGATGGGATGGAGGGAGGACGG - Intergenic
976484861 4:85590244-85590266 ATGGAGGGATGGAGGGAGGTGGG - Intronic
976962712 4:90998880-90998902 ACTAGGGCATGGAGGGAGGGAGG - Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978170370 4:105662720-105662742 CTGAGGTCATGGTAGAAGGTGGG + Intronic
978199394 4:106007652-106007674 CAGAGGGAATGGTGGGAGGGAGG - Intergenic
979300627 4:119082316-119082338 TTGATGGCCTGGAGGAAGGTCGG - Intergenic
979669102 4:123343574-123343596 CTGTGTGCTTGGAAGGAGGTGGG - Intergenic
980115964 4:128679186-128679208 CAGTGGGCATGGTGGAAGGTGGG + Intergenic
981205414 4:142034534-142034556 CTGAGGGCTGGAAGGGAGTTGGG - Intronic
981547257 4:145906510-145906532 CTGAGGGTGTGGAGGGGGTTAGG - Intronic
982017444 4:151168927-151168949 GTGAGGGCATGGATGGGGGTAGG + Intronic
982398848 4:154943458-154943480 TTCAGGCCATGGTGGGAGGTGGG + Intergenic
982617752 4:157662755-157662777 CTGAGGACTTGGTGGGAGTTTGG + Intergenic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983721966 4:170866109-170866131 CTGAGGGCAAGGGGAGAGATTGG - Intergenic
983851984 4:172592408-172592430 GTGTGGGGATGGTGGGAGGTAGG - Intronic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985719380 5:1481311-1481333 CGGAGAGCATGGAGGGAGGGAGG - Intronic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
986207015 5:5634451-5634473 CTGAGAGCTGGGAAGGAGGTTGG - Intergenic
986479861 5:8175995-8176017 CTGAGGGCATGGTGGGAGGTGGG + Intergenic
986738935 5:10689014-10689036 CCGAGGGCAGGGAGGAAGGGCGG - Intronic
988148100 5:27337171-27337193 CTCAGGGGAGGGCGGGAGGTGGG + Intergenic
988511711 5:31869843-31869865 CTGAGGGCAGAGAGAGGGGTGGG + Intronic
988554636 5:32225374-32225396 GTGAGGGCATGGAGGGACTTGGG - Intergenic
989697717 5:44223157-44223179 ATGAGGGGAGGGAGGGAGGGAGG + Intergenic
990241455 5:53820207-53820229 CTGAGGGGAGGAAGGGAGGGAGG + Intergenic
991021812 5:61987248-61987270 CTGTGGGGATTGAGGGAGATTGG + Intergenic
991099421 5:62776165-62776187 CATAGGGAATTGAGGGAGGTGGG + Intergenic
991107695 5:62862376-62862398 CTCAGCTCATGGAGGAAGGTTGG - Intergenic
991497548 5:67242346-67242368 CTGATGGCATGTTGGGAGGATGG + Intergenic
992135115 5:73736840-73736862 GTGAGGGGAGGGAGGGAGGGAGG + Intronic
992166362 5:74055925-74055947 CTGGGGGCATGGGGGAAGGAGGG - Intergenic
992530728 5:77649292-77649314 ATGAAGGCATGGAGGGAAGTAGG - Intergenic
992674518 5:79092333-79092355 TTGTGGGGATTGAGGGAGGTGGG - Intronic
992877218 5:81068827-81068849 CTGAGGCCTGGGAGGGAGGGAGG - Intronic
993318157 5:86437454-86437476 CTGAAGGAATGGCAGGAGGTGGG + Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
994180961 5:96765531-96765553 CTGAGGGGATTCTGGGAGGTAGG + Intronic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
994994036 5:107036853-107036875 CTGGGGGGATGAAGAGAGGTGGG + Intergenic
995087302 5:108127586-108127608 CTTAGGACATGGAAGGAGCTAGG + Intronic
995376624 5:111481387-111481409 GAGAGGACATGGAGGAAGGTAGG - Intronic
996540903 5:124629424-124629446 CTGAGGGGATGGTGGGGGCTGGG + Intergenic
997582796 5:135028043-135028065 GTGCGGGCCTGGCGGGAGGTGGG - Exonic
997886500 5:137634859-137634881 CTGAGGGCTGAGAGTGAGGTTGG + Intronic
998136253 5:139676184-139676206 AGGAGGGCTTGGGGGGAGGTGGG - Intronic
998136362 5:139676464-139676486 AGGAGGGCTTGGGGGGAGGTGGG - Intronic
999294459 5:150449793-150449815 CTGAGGTCACGGGGCGAGGTCGG + Intergenic
999389611 5:151180613-151180635 CTGTGGCCAGGGAGGGAGCTAGG - Intergenic
999823522 5:155252222-155252244 CAGAGGCCATGGATGGAGGAAGG + Intergenic
1000129270 5:158279743-158279765 CTGAGGAGATGGAGAGAGATGGG - Intergenic
1000218655 5:159189898-159189920 CTGGGGGCAGGGAGGGTGGTGGG + Intronic
1001594429 5:172888769-172888791 CAGAGGGCATGGCCAGAGGTTGG - Intronic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1002077362 5:176716733-176716755 CTAACAGCTTGGAGGGAGGTAGG + Intergenic
1002077823 5:176719638-176719660 CTGAGGGAAGGGATGGTGGTGGG - Intergenic
1002281995 5:178136420-178136442 CAGAGGGGATGGTGGGGGGTGGG + Intronic
1002771479 6:293517-293539 CTGACGGCATGTAGAGATGTGGG - Intronic
1002820873 6:723532-723554 CTCTGGGCATGGAGAGAGGATGG + Intergenic
1003379580 6:5611238-5611260 CTGAGGGCCAGAAGTGAGGTAGG + Intronic
1003571425 6:7258752-7258774 GTGAGGGCAGGAGGGGAGGTGGG + Intergenic
1003860680 6:10319418-10319440 CCGTGGGGATGGAGGGATGTGGG + Intergenic
1003860777 6:10319750-10319772 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1003860787 6:10319780-10319802 CCGTGGGGATGGAGGGACGTGGG + Intergenic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004417152 6:15435450-15435472 TTTAGGGCTTGGAGGGTGGTAGG + Intronic
1004468758 6:15909508-15909530 CTGAGCACCTGGAGGGAGGAAGG + Intergenic
1004493652 6:16142644-16142666 CTGTGGCCAGGGAAGGAGGTAGG - Intronic
1005841681 6:29748172-29748194 CTGAGGGCAGGGGAGGAGGTGGG + Intergenic
1006187325 6:32188860-32188882 CTGAGAACAAGGAGGGAGGAGGG + Intronic
1006299469 6:33185934-33185956 TTGAGGGTCAGGAGGGAGGTGGG + Intronic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1007096183 6:39214644-39214666 CCGAGGGCTTGTAGGGAGGGAGG + Intronic
1007304268 6:40892068-40892090 TGGAGGTCATGGAGAGAGGTGGG - Intergenic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008319421 6:50089771-50089793 TTGAGGGCAGGGAGAGAGATTGG - Intergenic
1008496842 6:52142905-52142927 CTGATGGCAGGGAGGCAGCTTGG - Intergenic
1010395853 6:75391165-75391187 ATGAGCGCATGGAAGGAGGAGGG - Intronic
1010418267 6:75641095-75641117 AGGAGAGGATGGAGGGAGGTGGG - Intronic
1012052608 6:94362548-94362570 CTCTGGGCCTGGAGGGGGGTGGG + Intergenic
1012082178 6:94773866-94773888 TTGTGGGCATGGTAGGAGGTGGG - Intergenic
1012978452 6:105805023-105805045 CTTGGGGGATGGTGGGAGGTGGG + Intergenic
1014078512 6:117264418-117264440 CAGAGGGCTTGGTGGGGGGTAGG + Intergenic
1015121763 6:129708168-129708190 TTGAGGGCAGGGAGGAAGGAGGG - Intronic
1015185902 6:130415195-130415217 CAGAGGGCAAGCAGGGAGTTAGG + Intronic
1015190662 6:130468233-130468255 CAGAGGGCCTGGAAGGAGGCTGG - Intergenic
1015863354 6:137703178-137703200 CTGGAGGCAAGGAGGTAGGTGGG - Intergenic
1016536627 6:145113683-145113705 GTGAGGCCATGGACAGAGGTGGG - Intergenic
1016867174 6:148778867-148778889 CGGATGGGATGGAGGGGGGTGGG - Intronic
1017858321 6:158371281-158371303 CTGGGAGCATGGAGTGAGATGGG + Intronic
1018818264 6:167351976-167351998 CTGAGGGGAGGGAGAGAGATGGG - Intronic
1018906799 6:168080273-168080295 CTGAGCGGAGGGAGGGAGGGAGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019217131 6:170451295-170451317 CCGAGGGCAGGGAGGGGCGTGGG + Intergenic
1019324172 7:429945-429967 CGGAGGCGATGGAGGGAGGCAGG - Intergenic
1019327445 7:445404-445426 GTGAGGGCATGCAGGGTGATGGG - Intergenic
1019557207 7:1638527-1638549 CTGAGAGGAGGGAGGGAGGGAGG + Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019806465 7:3129933-3129955 GTGAGGGGAAGGAGGGAGGGAGG + Intergenic
1019823106 7:3260725-3260747 CTGAGGGCCAGGAGGGAATTTGG - Intergenic
1020103144 7:5406942-5406964 CTGGGGGCTGGCAGGGAGGTGGG - Intronic
1020116381 7:5478635-5478657 CTGTGGGGTTGGAGGGAGGGAGG - Intronic
1020325315 7:6969660-6969682 ATGGGGGCATGGAGTTAGGTGGG + Intergenic
1020342871 7:7131510-7131532 CTGAGGGCTTGAGGGGAAGTAGG - Intergenic
1020604550 7:10320031-10320053 ATGAGGAAATGGAGGGAGGGAGG - Intergenic
1020638614 7:10727750-10727772 CTGAGGTCAAGGAGAGAGCTTGG - Intergenic
1020901549 7:14009652-14009674 CTGAGGGGCTGGATGGAGGGAGG - Intergenic
1021479101 7:21096070-21096092 CTCCTGGCATGCAGGGAGGTTGG - Intergenic
1023706491 7:42946745-42946767 CAGAGCTCATGGAGGGAAGTTGG + Intronic
1023920926 7:44629323-44629345 CTGAGGGAGTGGAAGGAGCTGGG + Intronic
1024963776 7:55004494-55004516 CTGGTGGCTTGGAGGGACGTTGG + Intergenic
1025205603 7:56991935-56991957 CAGAGGGCAAGGCGGGAGCTTGG - Intergenic
1025666337 7:63585003-63585025 CAGAGGGCAAGGCGGGAGCTTGG + Intergenic
1026179785 7:68028789-68028811 CGGAGGGAAGGGAGGGAGGGAGG - Intergenic
1026557563 7:71421536-71421558 CTGAGGAACTGGAGGGATGTTGG + Intronic
1026734458 7:72940906-72940928 CTTGGGGCCAGGAGGGAGGTGGG - Exonic
1026784790 7:73295814-73295836 CTTGGGGCCAGGAGGGAGGTGGG - Intergenic
1026846269 7:73700630-73700652 CTGAGAGAAGGGAGAGAGGTGGG + Intronic
1027109286 7:75424114-75424136 CTTGGGGCCAGGAGGGAGGTGGG + Exonic
1028101785 7:86829605-86829627 CTGAGGTGATGGAGAGAGATAGG + Intronic
1028243782 7:88451926-88451948 ATGAGGGGAGGGAGGGAGGTGGG - Intergenic
1028902923 7:96121226-96121248 CTGATGGCTTGAAGAGAGGTAGG + Exonic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1030394099 7:108963728-108963750 GTGAGGTCATGGAGGTAGCTTGG + Intergenic
1030411356 7:109184250-109184272 CTGAGAGCATAGTTGGAGGTTGG + Intergenic
1032016217 7:128381822-128381844 GTGAGGGCCTGGCGGGGGGTGGG - Intergenic
1032517466 7:132517809-132517831 CTGAGGGCAGTGAGGGAGTTGGG + Intronic
1032689005 7:134263941-134263963 CTGAGGGATTGGAGGGAGGGTGG - Exonic
1033223315 7:139542965-139542987 CGGAGGGCATGGGGTGGGGTGGG + Intronic
1033226594 7:139567863-139567885 CTGAGGGCAGGGTGGGGTGTGGG - Exonic
1033435227 7:141327658-141327680 CTGAGGACATGTTGGGAGGTAGG + Intronic
1033554119 7:142473661-142473683 CTGAGGGAATGGAGGAGGCTGGG + Intergenic
1033558752 7:142511181-142511203 CTGGGGGAATGGAGGAAGCTGGG + Intergenic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034203081 7:149294525-149294547 CGGGGGGCCTGGAGGGAGGGAGG - Intronic
1034299005 7:149998890-149998912 CTGAGGGAGTGGTGGGAGGGAGG - Intergenic
1034450249 7:151133427-151133449 CCGAGTGCAGGGAGGGAGGGTGG - Intronic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034675544 7:152890374-152890396 CTCAGGGCCTGGTGGGAGGGTGG + Intergenic
1034686048 7:152972398-152972420 CTGAGAGCATAGAGGCAGGAAGG + Intergenic
1034807011 7:154097883-154097905 CTGAGGGAGTGGTGGGAGGGAGG + Intronic
1034899208 7:154897142-154897164 CTGAGGCCAGGGAAGGAGGGAGG + Intergenic
1034953371 7:155316503-155316525 GTGCGGGCAACGAGGGAGGTGGG + Intergenic
1035371994 7:158385973-158385995 CTCAGGGCATGGGAGGAGGGAGG - Intronic
1035372084 7:158386244-158386266 CTCAGGGCATGGGAGGAGGGAGG - Intronic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1036001749 8:4612701-4612723 CTCAGGGTATGGAGGCTGGTGGG + Intronic
1036370754 8:8161149-8161171 ATGGGGGCATGGAGCTAGGTGGG - Intergenic
1036478188 8:9113395-9113417 CTGAGGAGAGGGAGGGAGATTGG + Intronic
1036623630 8:10446020-10446042 CTGGAAGGATGGAGGGAGGTGGG + Intergenic
1036701844 8:11018213-11018235 CTGATGGCAGGGAGGGAGTTGGG - Intronic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1036880139 8:12504481-12504503 ATGGGGGCATGGAGCTAGGTGGG + Intergenic
1036899512 8:12660233-12660255 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1036900576 8:12666380-12666402 CTGTGGGGATGGAGCGTGGTGGG + Intergenic
1037607181 8:20447820-20447842 GTGAGGCCCTGTAGGGAGGTAGG - Intergenic
1037654202 8:20868889-20868911 GGGAGGGAGTGGAGGGAGGTGGG - Intergenic
1037802627 8:22043756-22043778 AGGTGTGCATGGAGGGAGGTGGG - Intronic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039956964 8:42215104-42215126 GTGATGCCATGGCGGGAGGTGGG - Intergenic
1040012428 8:42673340-42673362 ATGAGGCCATGAAGGGAGTTTGG - Intergenic
1040812830 8:51475769-51475791 GTGAGGGAAGGGAGGGAGGGGGG - Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1040921419 8:52624016-52624038 TTGAGGGGTTGGAGGGATGTGGG + Intronic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1042654974 8:71085861-71085883 CTGAAGACATGGGGGCAGGTGGG + Intergenic
1042882413 8:73508359-73508381 CTGAGGAGATGGAGAGAGATGGG + Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044030890 8:87235507-87235529 CTGAGGACAGGGAGAGAGATGGG + Intronic
1044177255 8:89142716-89142738 CAGAGGGCATGGGGAGAGGTAGG - Intergenic
1044732238 8:95238700-95238722 TGCAGGGCAGGGAGGGAGGTGGG - Intergenic
1045000140 8:97871289-97871311 GAGAGGGCAAGGAGTGAGGTGGG + Intronic
1045217527 8:100163086-100163108 CTGATCACATGGAGGGTGGTGGG + Intronic
1045583286 8:103501084-103501106 CGGAGGGCAGGGAGAGAGGCGGG - Intronic
1045811024 8:106220285-106220307 GTGAGGACATGGATGGAGATGGG + Intergenic
1046997789 8:120543591-120543613 CTCAGGACAAGGAGGGATGTGGG + Intronic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1047953667 8:129956816-129956838 CTGGGGGGAGGGAGGGAGGGAGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1049203435 8:141352574-141352596 CTGAAGGCATGGAGCGGGGTGGG - Intergenic
1049326095 8:142022341-142022363 CTGTGGGCCTGGTGGGGGGTCGG - Intergenic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049597702 8:143492338-143492360 CTGAGGCCCTGGTGGGAGGAGGG - Intronic
1049632671 8:143667024-143667046 GTGTGCACATGGAGGGAGGTAGG - Intergenic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1049865589 8:144933607-144933629 CTGTGGGCAGGAGGGGAGGTTGG - Intronic
1050412629 9:5382571-5382593 CTGAGGTAATGGAGGAAGGAGGG + Intronic
1051356634 9:16245310-16245332 CTGAGAGCTTGGAGGTAGCTAGG + Intronic
1051508310 9:17848982-17849004 CTGAGGGCCTGGCAGGAGTTGGG - Intergenic
1051556119 9:18384486-18384508 ATGAGGGCATTGAAGGAGGAAGG - Intergenic
1051858961 9:21601960-21601982 CTGAAGGCATGGAGTGAGCGAGG - Intergenic
1052998357 9:34563869-34563891 CTGAGTGGAGGGAGGCAGGTTGG - Intronic
1053040584 9:34867395-34867417 CAGAGGTAATGGAGAGAGGTGGG + Intergenic
1053104685 9:35399489-35399511 CTGAAGTCATGGAGAGAGGGTGG + Intronic
1053153502 9:35757358-35757380 CTGACTGTATGGAGGCAGGTGGG + Exonic
1053198155 9:36136031-36136053 CTGAGGAAAGGCAGGGAGGTGGG + Intergenic
1053262776 9:36684746-36684768 CAGGGGGCAGGGTGGGAGGTAGG - Intergenic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1057075374 9:92135666-92135688 CTGGGGGCATGGAGGGCTCTTGG + Intergenic
1057191371 9:93089754-93089776 CTGGGGGCAGGGAAGGAGGGAGG - Intergenic
1057414244 9:94847213-94847235 CTGCAGGCATGGTGGGAGGGTGG - Intronic
1057875342 9:98749318-98749340 CTGGGGTCAGGGAGGGAGCTGGG - Intronic
1057904746 9:98974944-98974966 CTGAGGCCATGCAGTGAGTTTGG - Intronic
1057978578 9:99634322-99634344 CTGAGAGCATGGTGGGAATTAGG - Intergenic
1058615160 9:106818369-106818391 CTAATGGCATGGAGGGAGATTGG - Intergenic
1058765743 9:108181208-108181230 CTTAGGGCTTGGTGGGAGATAGG + Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059340876 9:113597005-113597027 CAGGGGGCAGGGAGGCAGGTGGG - Exonic
1059394841 9:114027878-114027900 CTGAGGGCAGGAAGGGGGCTAGG - Intronic
1059776700 9:117483339-117483361 CTAAGGGCAGGGTGGGAGCTTGG - Intergenic
1059988297 9:119840880-119840902 CAGAGAGCAAGGAGGAAGGTGGG + Intergenic
1060015744 9:120084821-120084843 GTGGGGGCATGGAGAGAGTTGGG - Intergenic
1060106920 9:120878399-120878421 CTGAGGGCAAGGATGGGGGTGGG - Intronic
1060110378 9:120902492-120902514 CTGTGGGCAGGGCGGGGGGTGGG + Exonic
1060424512 9:123493293-123493315 CTGTGGGCAACCAGGGAGGTTGG + Intronic
1061218992 9:129238019-129238041 CAGAGGCCAGGCAGGGAGGTGGG - Intergenic
1061371402 9:130199624-130199646 ATGACAGCATGGAGGGAGGATGG - Intronic
1061488117 9:130930575-130930597 TGCAGGGCATGGGGGGAGGTGGG - Intronic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062343785 9:136105441-136105463 CAGAGAGCAGGGAGGGAGCTGGG + Intergenic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1186372279 X:8959461-8959483 CTGAGTGCATCGAATGAGGTGGG + Intergenic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186753039 X:12641389-12641411 CTGAGAGCATGGAGGGGAGGGGG - Intronic
1188423728 X:30022414-30022436 TTGGAGGCAAGGAGGGAGGTTGG - Intergenic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1188977626 X:36694055-36694077 GTGGGGGCCTGGCGGGAGGTGGG + Intergenic
1189323144 X:40098052-40098074 CTGTTGGGAGGGAGGGAGGTAGG - Intronic
1190013383 X:46804976-46804998 CTGGGGGCAGGGAGTGAGGTGGG - Intergenic
1190303196 X:49067978-49068000 CAGCGGGCATGGAGGAAGGGTGG - Exonic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1191684888 X:63879531-63879553 CTGTGGTCATGGTGGCAGGTTGG - Intergenic
1191688953 X:63920512-63920534 CTTAGGGGATGGGGGGAGGCTGG + Intergenic
1192233945 X:69284536-69284558 CTGGGGGCAGGATGGGAGGTGGG - Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193775978 X:85642093-85642115 CTGGGGGCATTGAGGGGGCTGGG - Intergenic
1195006469 X:100690419-100690441 CTAAGAGAATGGAGGGAGGGAGG + Intronic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195705004 X:107732250-107732272 CTGAGTCCTTGGAGGGAGTTTGG - Intronic
1195708574 X:107756612-107756634 CTGAGAGGAAGGAGGGAGGGAGG - Intronic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196405699 X:115360331-115360353 CTGAGTGCATGGGTAGAGGTGGG - Intergenic
1197862046 X:130981142-130981164 GTGAGAGGGTGGAGGGAGGTGGG + Intergenic
1197977923 X:132185002-132185024 CTGAGGGCAGGGATGGAGTGTGG - Intergenic
1199757679 X:150880531-150880553 CTGAGGGCCAGGGGGAAGGTGGG + Intronic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199825837 X:151498419-151498441 GTGTGGACAGGGAGGGAGGTGGG + Intergenic
1199963745 X:152801038-152801060 GTGTGGGAAGGGAGGGAGGTGGG - Intergenic
1200080833 X:153575577-153575599 CTAAGGGCATGGAGGGGTGGGGG + Intronic
1201144719 Y:11057975-11057997 ATGAGTGGATGGAGGGAGGGAGG + Intergenic
1201636571 Y:16129028-16129050 CTGAAGGCTTGGAGGCAGGAAGG - Intergenic
1202098871 Y:21284533-21284555 GTGTGGGGTTGGAGGGAGGTGGG - Intergenic