ID: 1175219544

View in Genome Browser
Species Human (GRCh38)
Location 20:57409032-57409054
Sequence CTGTCTTGGGGGTTGGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 576
Summary {0: 1, 1: 2, 2: 6, 3: 57, 4: 510}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175219526_1175219544 20 Left 1175219526 20:57408989-57409011 CCCCCGCACCACCTGCTGTGTGC 0: 1
1: 0
2: 0
3: 29
4: 298
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219529_1175219544 17 Left 1175219529 20:57408992-57409014 CCGCACCACCTGCTGTGTGCCAG 0: 1
1: 1
2: 6
3: 80
4: 500
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219527_1175219544 19 Left 1175219527 20:57408990-57409012 CCCCGCACCACCTGCTGTGTGCC 0: 1
1: 1
2: 13
3: 378
4: 871
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219531_1175219544 9 Left 1175219531 20:57409000-57409022 CCTGCTGTGTGCCAGCCTGAGAC 0: 1
1: 0
2: 4
3: 51
4: 501
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219533_1175219544 -2 Left 1175219533 20:57409011-57409033 CCAGCCTGAGACGGTTCCTGCCT 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219525_1175219544 26 Left 1175219525 20:57408983-57409005 CCTCTACCCCCGCACCACCTGCT 0: 1
1: 0
2: 2
3: 49
4: 547
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219528_1175219544 18 Left 1175219528 20:57408991-57409013 CCCGCACCACCTGCTGTGTGCCA 0: 1
1: 1
2: 1
3: 28
4: 374
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219524_1175219544 27 Left 1175219524 20:57408982-57409004 CCCTCTACCCCCGCACCACCTGC 0: 1
1: 0
2: 0
3: 28
4: 368
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219530_1175219544 12 Left 1175219530 20:57408997-57409019 CCACCTGCTGTGTGCCAGCCTGA 0: 1
1: 1
2: 7
3: 37
4: 319
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510
1175219534_1175219544 -6 Left 1175219534 20:57409015-57409037 CCTGAGACGGTTCCTGCCTGTCT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG 0: 1
1: 2
2: 6
3: 57
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175219544 Original CRISPR CTGTCTTGGGGGTTGGTGGA GGG Exonic
900523394 1:3116857-3116879 CAGTCACGGGGGTTTGTGGAGGG - Intronic
900919823 1:5663048-5663070 CTGGCCTGGGTGTGGGTGGAGGG - Intergenic
902540977 1:17154504-17154526 CTGACTTGGAGGCTGGAGGAAGG - Intergenic
902719934 1:18297175-18297197 CTGTCCTGGGGGTTGGGGAGAGG - Intronic
903056441 1:20639439-20639461 TTGTCGTGGGGGATGGAGGAAGG + Intronic
903691156 1:25174605-25174627 TAGCCTTGGGGGCTGGTGGATGG - Intergenic
903866648 1:26403695-26403717 CAGACTTGGGGATTGCTGGAAGG + Intergenic
904043544 1:27597672-27597694 CTGGCCTGGGGGTTTGGGGAGGG + Intronic
904247629 1:29198965-29198987 CTGTCTAGGTGGTTGTGGGAAGG + Intronic
904499213 1:30904531-30904553 GTGTGTTGGGGGTTGGTGCGAGG - Intronic
905541575 1:38764412-38764434 CTGGCTGGTGGGTGGGTGGAAGG + Intergenic
905583470 1:39099685-39099707 CTGTTATGGGGGTTGGGGGAGGG - Intronic
905915773 1:41683295-41683317 CCCACTTTGGGGTTGGTGGAAGG - Intronic
906455260 1:45990464-45990486 TTGTTTTGGGGGTTGGGGGTTGG + Intronic
906673987 1:47679975-47679997 CAGCCTTGAGGGGTGGTGGAGGG - Intergenic
907806010 1:57821061-57821083 CTTTTTTGGGGGTGGGTGAAAGG - Intronic
908044547 1:60154464-60154486 GGGTGGTGGGGGTTGGTGGAGGG + Intergenic
908264265 1:62362767-62362789 CTGCCATGGGGGTGGGGGGAAGG + Intergenic
908450185 1:64246954-64246976 TGGCCTTGGGGATTGGTGGAAGG + Intronic
908543835 1:65146500-65146522 CTTTGATTGGGGTTGGTGGAGGG - Intergenic
908879488 1:68714598-68714620 CTGTCATGGGGGTTGGGAGAAGG + Intergenic
910384149 1:86663440-86663462 CTGTCTTGGGGTTGGGGGGGAGG + Intergenic
910607442 1:89102425-89102447 CTGTTTCGGGGGGTGGTGAAGGG - Intergenic
910892057 1:92028836-92028858 CTGTCTTGGGGTGAGGGGGAGGG - Intergenic
911589335 1:99728603-99728625 ATGGCTTGGAGGTTGGCGGACGG - Exonic
911812918 1:102307309-102307331 CTGTTGTGGGGGTCGGGGGAGGG - Intergenic
912637018 1:111305522-111305544 CTGCCTTGGGGCTTAGTGGTGGG + Intronic
912964488 1:114226073-114226095 GTGTCTTGGTGTTTGGTTGATGG - Intergenic
913094253 1:115501653-115501675 CTGTTCTGGGGTTTGGTGGAAGG + Intergenic
913359497 1:117964087-117964109 CAGGCTTGGGGGTTAGAGGATGG + Exonic
913592356 1:120341511-120341533 CAGACTTGGGGGTGGGGGGAGGG + Intergenic
913651003 1:120913634-120913656 CAGACTTGGGGGTGGGGGGAGGG - Intergenic
914170111 1:145215433-145215455 CAGACTTGGGGGTGGGGGGAGGG + Intergenic
914525228 1:148459396-148459418 CAGACTTGGGGGTGGGGGGAGGG + Intergenic
914598448 1:149176434-149176456 CAGACTTGGGGGTGGGGGGAGGG - Intergenic
914726272 1:150330358-150330380 CTTTTTTGGGGGGTGGGGGATGG + Intronic
915052422 1:153089533-153089555 TTGTCTTGGTTGTTGGTGTACGG - Intergenic
915461029 1:156070705-156070727 CTGCCCTGGGGGTTGGCAGAGGG - Intergenic
915901606 1:159850658-159850680 CTGTCTTGGGGGTGGGAAGGTGG - Intronic
917390568 1:174531737-174531759 CTGTCTCGGGGGTGGGGGGGGGG + Intronic
918038927 1:180900263-180900285 CTGACTTGGGGGTTGTTGGGAGG + Intergenic
918180438 1:182082288-182082310 CTGTCTGGGTGGTGGGTGGGAGG - Intergenic
920075565 1:203334002-203334024 CTGTCTTGGCGGCTGGTATATGG + Intergenic
920873771 1:209815950-209815972 CTGTCCTGGGGGTGGGAAGAAGG + Intergenic
922212280 1:223495476-223495498 CTGGCTTGGGGGCTGGTAAATGG - Intergenic
922919314 1:229288138-229288160 TTGTTTTGGGGTTTGTTGGAGGG + Intronic
923614523 1:235525832-235525854 CTGTCCTGGGAGTGGGTGCAGGG - Intergenic
923748190 1:236722933-236722955 CTGGATTTGGGGTTGGAGGAGGG + Intronic
1062774245 10:132428-132450 CTTTCTTGGGGGTCTGAGGATGG + Intergenic
1062877569 10:954945-954967 CTGTCCTGGGGAAGGGTGGATGG - Intergenic
1062877606 10:955075-955097 CTGTCCTGGGGAAGGGTGGATGG - Intergenic
1063369856 10:5514127-5514149 CTGTGCTGGGGGGTGGTGGGTGG - Intergenic
1063978951 10:11438285-11438307 CTGACTGGTGGGTGGGTGGATGG + Intergenic
1064213349 10:13379441-13379463 CTGTCATGGGTGTGGGGGGAGGG + Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064608519 10:17071495-17071517 TTGGCTTTGGGGCTGGTGGATGG + Exonic
1067944336 10:50680845-50680867 CTGCCTGGGGTGTAGGTGGAAGG + Intergenic
1068528336 10:58156614-58156636 CTGTTTTGGGGGTAGGAGGCTGG + Intergenic
1068538017 10:58262087-58262109 CTGTCGTGGGGTTGGGGGGATGG + Intronic
1068577208 10:58697919-58697941 CTGTCATGGGGGTGGGAGGTGGG - Intronic
1069554309 10:69387223-69387245 CTGTGTTGTGGTTTGGGGGAAGG - Intronic
1070634872 10:78117219-78117241 CTGTCTGGGGGGCTGTTGCAGGG - Intergenic
1070638175 10:78145859-78145881 CTCTAGTGGGGGTTGGGGGAAGG + Intergenic
1070879629 10:79845847-79845869 CTGCCTGGGGTGTAGGTGGAAGG + Intronic
1070890937 10:79941856-79941878 CTGCCTTTGTGGGTGGTGGAGGG + Intronic
1071016692 10:81005613-81005635 GTGTGGTGGGGGTTGGGGGAGGG + Intergenic
1071511688 10:86266252-86266274 GTGCATTGGGGGTTGGTGGCAGG - Intronic
1071632735 10:87229937-87229959 CTGCCTGGGGTGTAGGTGGAAGG + Intronic
1071646184 10:87362155-87362177 CTGCCTGGGGTGTAGGTGGAAGG + Intronic
1072175807 10:92920527-92920549 ATGTTTTGGGGGTGGTTGGAGGG - Intronic
1072323428 10:94273049-94273071 CTGTCAAGGAGGTGGGTGGAGGG - Intronic
1072365587 10:94705355-94705377 CTGTCCGGGGTGTTGGTGGAGGG + Intronic
1072429157 10:95355916-95355938 TTGTCTGGGGTGGTGGTGGAGGG + Intronic
1073345081 10:102776836-102776858 CTGTGTTGGGGGTGGGGTGAGGG + Intronic
1073423080 10:103440066-103440088 CTGTTGTTGGGGATGGTGGAGGG + Intronic
1074179885 10:111050375-111050397 CTGTCTTGGGGGTTGCAGGATGG + Intergenic
1075541308 10:123316791-123316813 CTGTCTTCTGGGCTGTTGGAGGG - Intergenic
1075874230 10:125793333-125793355 GTGACTTGGGGGTGGGTGGGTGG + Intronic
1076503322 10:130954201-130954223 CTCACTTGGGGGTGGGGGGATGG + Intergenic
1076766031 10:132633745-132633767 CTGCCTTGGGTGTTGCTGGCTGG + Intronic
1077339462 11:2019588-2019610 CTGGCTTGGTGGTTTGTAGAGGG - Intergenic
1078982322 11:16550310-16550332 CTGTCTTGGGGTTGGGGGAAGGG + Intronic
1079070313 11:17339499-17339521 CTGTTGTGGGGGTGGGGGGAGGG - Intronic
1079129080 11:17737184-17737206 GTGGCTTGGAAGTTGGTGGAGGG + Intronic
1080007066 11:27420762-27420784 GTGTCTTGGGGGAAGGTGGAGGG + Intronic
1080030661 11:27657283-27657305 CTGGCTTAGGGGATGGGGGATGG - Exonic
1081557761 11:44182028-44182050 CTGTTTTGGGGGTTGGGGAAAGG + Intronic
1082083690 11:48031855-48031877 CAGTGTTGGGGCTTGGGGGATGG + Intronic
1083063947 11:59903990-59904012 CTGTTTTGGGGGAGGGGGGAGGG + Intergenic
1083156807 11:60828433-60828455 CTGTCATGAGGGTCGGGGGAAGG - Intergenic
1083268491 11:61558378-61558400 CTGGCATGGGGGTTGGAGGGGGG + Intronic
1084172365 11:67406701-67406723 CTGACATGGGGGCTGGAGGAAGG + Intronic
1084413370 11:69016588-69016610 CGGTCTGGTGGGTGGGTGGATGG - Intergenic
1084587895 11:70073843-70073865 CTGTCTTGGGGGTGGGGGGCGGG - Intergenic
1084658138 11:70531322-70531344 CTGTGCTGGGGGCTGGTGGTGGG + Intronic
1085678916 11:78552296-78552318 ATGTCTTGGGGGAACGTGGATGG - Intronic
1085713905 11:78854706-78854728 GAATCTTGGGGGGTGGTGGAGGG + Intronic
1085829062 11:79880330-79880352 CAATCTTGGTGGTTGGAGGATGG - Intergenic
1087020534 11:93598326-93598348 CTCTGCTGGGGGTTGGTGGGGGG + Intergenic
1087087248 11:94232280-94232302 TTGTGTGGGGGGTTGGGGGAGGG - Intergenic
1087215424 11:95488141-95488163 CTGTCTCGGGGGTCGGGGGTCGG + Intergenic
1087721868 11:101674827-101674849 CTGTTTTGGGGGTTGGGGCATGG + Intronic
1087926514 11:103924954-103924976 GTGGGTTGGGGGTTGGGGGAGGG - Intronic
1088598092 11:111454819-111454841 CTGGGTTGGGGGTTGGGGGTTGG + Intronic
1089197783 11:116704980-116705002 TTGTCTTGTGGGGTGGTGGGTGG - Intergenic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1202822447 11_KI270721v1_random:74777-74799 CTGGCTTGGTGGTTTGTAGAGGG - Intergenic
1091398647 12:169759-169781 CTTTATTTGGGGCTGGTGGAGGG - Intronic
1092917116 12:13199100-13199122 CTGTCTTGGGAGTTGGCAAAAGG + Intronic
1092974301 12:13729489-13729511 CAGTCTTGGAGGCGGGTGGAAGG + Intronic
1093437306 12:19150317-19150339 CTGTTTTGGGGGATGGAGGAAGG + Intronic
1093782812 12:23156257-23156279 CTGTTGTGGGGGTGGGGGGAAGG - Intergenic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094462162 12:30708134-30708156 CTCTCTTGGTGGGTGGGGGAGGG + Intergenic
1095493714 12:42762674-42762696 TTGGCTTAGAGGTTGGTGGAAGG + Intergenic
1096386843 12:51199798-51199820 CTGGCTTGGGGCTTGGCTGAAGG + Exonic
1098440533 12:70512716-70512738 TGGACTTGGGGGGTGGTGGAAGG + Intergenic
1098574575 12:72026703-72026725 CTGTCTTTGGTTTTTGTGGAAGG + Intronic
1098922522 12:76315565-76315587 GTGTGTGGGGGGTTGGGGGAGGG - Intergenic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1099228869 12:80000400-80000422 CTGTATGGGGGGATTGTGGATGG - Intergenic
1100219829 12:92492981-92493003 CTGTGTTGGGGTTGGGAGGAGGG + Intergenic
1100326010 12:93540414-93540436 CTGGCTTTGAGGTTGGAGGAAGG + Intergenic
1100664848 12:96739835-96739857 CAGTTTTGGGGGTTGTTGGCTGG + Intronic
1101349344 12:103914001-103914023 GTGTCCTGGGGGTAGGAGGATGG - Intergenic
1101778435 12:107814867-107814889 CTGGCCTGGGGGTTAGGGGATGG - Intergenic
1101999432 12:109547691-109547713 GTGTGTTGGGGTTTGGGGGAGGG - Intergenic
1102469610 12:113152401-113152423 ATGTCTTGGGGATTGCTGAAGGG + Intronic
1103225242 12:119281871-119281893 GTGTCGAGGGGGTAGGTGGAGGG - Intergenic
1103297296 12:119898757-119898779 CTGTTGTGGGGGTGGGTGGAGGG - Intergenic
1103428263 12:120857811-120857833 CTGTCACAGGGGTGGGTGGAAGG + Intronic
1104500588 12:129281940-129281962 CTCCCTGTGGGGTTGGTGGAGGG + Intronic
1104564937 12:129872092-129872114 CTGTGATTGAGGTTGGTGGAAGG - Intronic
1104894876 12:132159199-132159221 CTGTCTTGGGGGGTGCTGGGCGG + Intergenic
1105836640 13:24217868-24217890 GTGACTTGAGGGTTGGGGGAAGG - Intronic
1105851389 13:24339431-24339453 CTTTCTTGGGGGGGGGTGGGGGG + Intergenic
1106295909 13:28413363-28413385 CTGGCTTGGGGGGTGGAGGGCGG - Intronic
1106754497 13:32809370-32809392 CTGGCTTGGAGGATGGAGGAAGG - Intergenic
1109118863 13:58427789-58427811 CTGTCTGGGGGGTGGGTCTAGGG + Intergenic
1109958213 13:69596850-69596872 CTGTTTTGGGGGTGGGTGAAGGG + Intergenic
1111993393 13:95138933-95138955 CTGTCATGGGGATGGGTGGTTGG - Intronic
1114201190 14:20522312-20522334 GAGGCTGGGGGGTTGGTGGAGGG + Intergenic
1114494898 14:23125938-23125960 CTGTCTTGGGGCAGGGTGAAAGG - Exonic
1115997835 14:39212077-39212099 CTCTCTAGGGGGATGATGGAGGG - Intergenic
1116149150 14:41116452-41116474 CTGATGTGGGGGATGGTGGAGGG - Intergenic
1116373829 14:44171870-44171892 CTGTCGGGGGGGTGGGGGGAGGG - Intergenic
1116671836 14:47851961-47851983 CTGTCGGGGGGGTTGGGGGAGGG + Intergenic
1116857998 14:49970451-49970473 CTGGCTGGGTGGTTGGTGTAGGG + Intergenic
1117010255 14:51463815-51463837 CTGTTTTTGGGGGTGATGGAGGG + Intergenic
1117923749 14:60754037-60754059 CTGACTTGGCGGTTAGTAGAAGG - Intronic
1119242691 14:73074566-73074588 CTGTCTTGTGGGGAGGTGGGGGG + Intronic
1119333000 14:73809479-73809501 GTGTCTTGGGTGGTGGTGGGAGG - Intergenic
1119739373 14:77004214-77004236 CTGAGTTGGGGGTTGGGGGAAGG + Intergenic
1120839750 14:89074882-89074904 CTGTCTGGGGGATAGGGGGAGGG + Intergenic
1120916323 14:89713679-89713701 CTGTCATGGGGTTGGGGGGAGGG - Intergenic
1122059594 14:99127941-99127963 CTGTAATGGGGGTGGGTGGGGGG - Intergenic
1122411539 14:101528435-101528457 CTGAGTTGGGGGTTGGGGTATGG + Intergenic
1122411935 14:101529993-101530015 CTGCCTTTGGGGTTGGTGAGAGG - Intergenic
1122545184 14:102517849-102517871 GTGTCCTGGGGGTTCCTGGATGG - Intergenic
1122557723 14:102590772-102590794 CAGCCTTGGGGGCTGGTGGGTGG + Intergenic
1122581536 14:102774918-102774940 CTGCTTTGGGGGTTGGTGGCGGG - Intergenic
1122742589 14:103880831-103880853 CTGTCTCAGAGGTTGGGGGAAGG - Intergenic
1122939758 14:104976045-104976067 CTTTCTTGGGGGGTCGTGGGAGG + Intronic
1123207969 14:106731982-106732004 CTGTTGTGGGGGTTGGGGGAGGG - Intergenic
1124637541 15:31374633-31374655 CTGCCTTGGGGAACGGTGGACGG - Exonic
1124880623 15:33639356-33639378 ATGCCTTGTGAGTTGGTGGAAGG + Intronic
1125589931 15:40847670-40847692 CTCTCTTGCGGGTGGGAGGAAGG + Intronic
1125792909 15:42383198-42383220 TTGTGATGGGGGTTGGGGGAAGG + Intronic
1125861665 15:43005406-43005428 CTGTCTTGGAGGGAGGTGGGGGG + Intronic
1127765046 15:62177414-62177436 CTGTCGGGGGGGTGGGGGGAGGG + Intergenic
1127826536 15:62708805-62708827 CTGTGCTGTGGGTGGGTGGATGG + Intronic
1128397550 15:67243578-67243600 CTGTCTTGTGCGTTGTAGGATGG - Intronic
1128518811 15:68361783-68361805 CTGTCTTGGGTCGTGGAGGATGG - Intronic
1128766524 15:70254443-70254465 CAATTATGGGGGTTGGTGGAAGG + Intergenic
1129109682 15:73330144-73330166 CTGTTTAGGGGGTTGGGGGGTGG - Intronic
1129361558 15:75027800-75027822 CTGTGATGGGGGGTGGTAGAGGG - Intronic
1130410132 15:83640133-83640155 CAGTCTTGGCAGTTTGTGGATGG - Intergenic
1130556526 15:84926783-84926805 CTGTGTGGGGGGTGGGGGGAGGG + Intronic
1131600838 15:93847162-93847184 CTGTTTGTGGGGTTGGGGGAGGG + Intergenic
1132025461 15:98401187-98401209 CCCTCTTGGGGGTTGCTGTATGG - Intergenic
1132147730 15:99438346-99438368 CTGTTTTGGGGGTGGGGAGAGGG + Intergenic
1132198181 15:99929454-99929476 CTGGCTTTGGGGATGGAGGACGG + Intergenic
1133520365 16:6550176-6550198 CTTTTTTGGGGGTTGGCGGGGGG + Intronic
1134237265 16:12476796-12476818 CTGTGTTTGGGGTTGATGGGTGG + Intronic
1134447039 16:14338560-14338582 TGGGCTTGGGGGTTGATGGATGG - Intergenic
1135052435 16:19203846-19203868 ATGGGATGGGGGTTGGTGGATGG + Intronic
1135888131 16:26332125-26332147 CTTGCTGGGGGCTTGGTGGAAGG + Intergenic
1136064876 16:27751902-27751924 CTGGCTTGGGGGCTGATGAACGG + Exonic
1136114834 16:28087971-28087993 GTGTCTGTGGGGTTGGGGGAGGG - Intergenic
1136138280 16:28271550-28271572 CTTTTTTGGGGGTGGGGGGACGG - Intergenic
1136479078 16:30530471-30530493 CTGTGTTGAGGGTTAGGGGAGGG + Intronic
1136568385 16:31083017-31083039 GGGTCGTGGGGGTGGGTGGAGGG - Exonic
1138196451 16:55055691-55055713 GTGACTCTGGGGTTGGTGGAGGG - Intergenic
1138879317 16:60991522-60991544 CTGTCATGGGGGTTGGGGGAAGG - Intergenic
1139126783 16:64088227-64088249 CTGTCATGGGGGCAGGTGGTGGG - Intergenic
1139839655 16:69868179-69868201 GTGTGTTGGGGGGTGGTGGCTGG + Intronic
1139891902 16:70258504-70258526 CAGTGGTGGTGGTTGGTGGAGGG - Intronic
1141347152 16:83257119-83257141 CTGAGTTGGGGGATGGAGGAAGG + Intronic
1141767439 16:86067891-86067913 CTCTCCTGGGGGTGGGTGGTTGG + Intergenic
1142007575 16:87696998-87697020 CCGTCTTGGGTGTGGATGGAGGG + Exonic
1142203100 16:88770401-88770423 CTGTCTGTGGGGTGGGGGGACGG + Intronic
1142428836 16:90015192-90015214 CTGTGTTGGGGCTTTGGGGAAGG + Intronic
1142479718 17:211629-211651 CTGCCTTGGGGGTGGATGGATGG + Intergenic
1142499378 17:323809-323831 CTGTCTCGCGGGGTGATGGAGGG - Intronic
1143107811 17:4538236-4538258 CTGGCTTGGGGGGTGGTGGCAGG - Exonic
1143483588 17:7240480-7240502 CTTTTTTGGGGGTAGTTGGAAGG - Exonic
1143490902 17:7284740-7284762 CTACCCTGGGTGTTGGTGGAGGG - Intronic
1143987823 17:10930324-10930346 CTGGCTTGGGTATTGGTGGATGG + Intergenic
1144748625 17:17633238-17633260 CTTCCTTGGGTGTTGGTGCAGGG - Intergenic
1145206931 17:20989596-20989618 CAGGCTTGGGGGTAGGTGCAGGG + Intergenic
1146911284 17:36649939-36649961 CTGACCTGGGGGCTGGGGGAGGG + Intergenic
1147017786 17:37506363-37506385 CTGGCTTGGGGGATGGGGGTAGG - Intronic
1147201747 17:38806857-38806879 ATGTCTTGGGGGTGAGTGGGAGG + Exonic
1147460313 17:40564089-40564111 TTGTGATGGGGGGTGGTGGAGGG + Intronic
1147512873 17:41086897-41086919 CTGTTGTGGGGGTGGGGGGAGGG + Intronic
1147649254 17:42052855-42052877 GTGACTTGGGGGTAGGGGGATGG - Intronic
1147871445 17:43590418-43590440 CTGTACTGGGGGTAGGGGGATGG - Intergenic
1148202226 17:45756768-45756790 CTGTCTTGGCTGTCGGTGGGTGG + Intergenic
1148237460 17:45978465-45978487 ATGACTTGGGGGTTGGGGGGAGG + Intronic
1148769538 17:50058971-50058993 CTGCCCTGGGGGTGGGAGGAGGG + Intronic
1148809057 17:50278931-50278953 CTCTCTGGGGGGATGATGGAGGG - Exonic
1148971818 17:51490452-51490474 CTGTCATCAGGGTTGATGGAGGG - Intergenic
1149083639 17:52687607-52687629 CAGTCTTGGAGATTGGTAGAGGG - Intergenic
1149520582 17:57315413-57315435 GGGGCTTGGGGGTCGGTGGAGGG + Intronic
1149991836 17:61387759-61387781 CTTTCTTGGGGGATGGGGGTGGG + Intronic
1150003465 17:61455931-61455953 CTGTCTGAGGGGTTGGGTGAGGG + Intronic
1150262224 17:63803417-63803439 CCGTCTTTGGGATTGGTGGCAGG + Intronic
1150323796 17:64239149-64239171 CTGTCTTGGGCATTGGTAAAAGG - Intronic
1150326436 17:64262420-64262442 CTGCCATGGGAGTTGGTGCAGGG - Intronic
1150490921 17:65573699-65573721 CTGTCTGGTGGGTTGTTGGGAGG + Intronic
1151147523 17:72054777-72054799 CTGTCTTGGAGATTGAGGGAGGG + Intergenic
1151558296 17:74858337-74858359 CTGGGTTGGGGGTTGGGGGTCGG + Intronic
1152225419 17:79090503-79090525 CTGTCTTGGGAGTTGGGGGCTGG + Intronic
1152327836 17:79651855-79651877 CAGTGATGGGGGGTGGTGGAGGG - Intergenic
1153960152 18:10133553-10133575 CCTTCTCGGAGGTTGGTGGATGG + Intergenic
1155990708 18:32276253-32276275 CTGTCCTGGGGGCTGATGGCCGG + Intronic
1156006740 18:32451245-32451267 CTAGCTTGGGGGTGGGGGGATGG - Intronic
1156036735 18:32772603-32772625 CTGTCTTTTGGATTGTTGGAGGG - Intronic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1157489929 18:48116124-48116146 CTGTCCTTGGGGGTGGGGGACGG - Intronic
1157498510 18:48172896-48172918 CTGTCTAGGGGGTGGTGGGAGGG + Intronic
1157802224 18:50630063-50630085 CTGTGTTGGGAGATGGGGGAGGG + Intronic
1157816343 18:50731920-50731942 CTGTATTTGGGGGTGGGGGAAGG + Intergenic
1158020561 18:52836756-52836778 CTGTCATGGGGTCTGGAGGATGG + Intronic
1158792350 18:60797314-60797336 CTGTCATGGGGTTGGGGGGATGG - Intergenic
1159572983 18:70141623-70141645 CAGAGTTGGGGGTTGGGGGAGGG + Intronic
1159760243 18:72416796-72416818 CTGTCATGAGGGTGGGAGGAGGG + Intergenic
1161209841 19:3060818-3060840 CTGTTTTGGGGGTTGAGGGATGG + Intronic
1161363780 19:3867361-3867383 CAGTCTTGGGGGCAGATGGACGG + Intronic
1161467855 19:4442131-4442153 CCGTGTTGGGGGTGGGAGGAAGG + Intronic
1162132651 19:8536642-8536664 CAGTCCTGGGGGTGGGTGGGAGG + Intronic
1163323292 19:16587111-16587133 GTGTGTTGGGGGTTGGGGGGTGG - Intronic
1163353140 19:16792207-16792229 CCCTGTTGGTGGTTGGTGGACGG + Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1163586273 19:18165800-18165822 CTTTGTTAGGGGTTGTTGGAAGG + Intronic
1163736914 19:18987413-18987435 GTGTGTTGGGGGTTGGCGGCAGG + Intergenic
1164592857 19:29515684-29515706 CTGGCTTGGAGGTGGGTGGTGGG - Intergenic
1164659733 19:29952873-29952895 ATGACTTGGGGTTTGGGGGAGGG - Intronic
1164667321 19:30050161-30050183 CTGTGTTGGGGGTGGGGGTAGGG + Intergenic
1165073721 19:33269561-33269583 CTGTGGTGGGTGTTGGGGGAGGG + Intergenic
1165342720 19:35224366-35224388 CTGACTTGGGGAGTGGTGGCTGG + Intergenic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1166087777 19:40488233-40488255 CTGTATTGCGGGTTGGGGGTGGG + Intronic
1166874981 19:45891441-45891463 CTGTCTTGGGGCTGGGGGGCGGG - Intronic
1167490502 19:49790231-49790253 CTGCCTTTGGGGATGGGGGAAGG - Intronic
1167829450 19:52007701-52007723 CTGTCTTGGGGGTTAAGGTACGG - Intronic
1168347847 19:55659552-55659574 CTGTCTTGGTGGTTGCTGGTGGG + Intronic
925026099 2:608504-608526 TTGTCTTGGTCGTTGGTGCAGGG + Intergenic
925156103 2:1649864-1649886 CTGTGTTTGGGGCTGGAGGAGGG - Intronic
925519164 2:4722474-4722496 CGGGGTGGGGGGTTGGTGGAGGG - Intergenic
925964137 2:9047787-9047809 GTGGCTTGGGGGTTGGGGGTTGG - Intergenic
926045054 2:9704081-9704103 CTGTTGTGGGGGATGGTGGCTGG + Intergenic
926254093 2:11175076-11175098 CTGTCTTAGGGTTTAATGGATGG + Intronic
928429200 2:31204020-31204042 CTGTTTTGGGGGTAGGAGGTTGG + Intronic
929630267 2:43452913-43452935 TTTTTTTGGGGGTGGGTGGAGGG - Intronic
930217894 2:48715710-48715732 CTGTGTTGTGGGTTGGTGGAAGG - Intronic
932428473 2:71658915-71658937 CTGTCTTGGGGGCATGGGGATGG - Exonic
932501391 2:72185889-72185911 CTGTCGTGGGGTTGGGGGGAGGG - Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934101751 2:88659905-88659927 CTCTCTTTGGGGTTGGGGGTAGG + Intergenic
936097017 2:109538166-109538188 CTGGCTTGGAGGGTGGAGGAAGG - Intergenic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
937407564 2:121644648-121644670 CCGTCTTGGGGGCCGGTGTAGGG + Intronic
937616142 2:123924067-123924089 ATGTCTTAGGGATTTGTGGAAGG - Intergenic
937758209 2:125566515-125566537 GGGTCATGGGGGTTGGAGGAAGG - Intergenic
938403375 2:131012572-131012594 GTGTGTTGGGGGGTGGGGGAGGG + Intronic
938413393 2:131084192-131084214 CTGTCTTGGGGTGGGGTGGGGGG - Intronic
939244513 2:139606450-139606472 CTGTCATGGGGGGTGGAGGGAGG + Intergenic
939705089 2:145442596-145442618 CTGTTGTGGGGGTGGGGGGAGGG + Intergenic
941001348 2:160206416-160206438 GGGTGCTGGGGGTTGGTGGAGGG - Intronic
941844470 2:170119536-170119558 CTGAGTTGGGGGTTGGGGGGTGG + Intergenic
942461361 2:176171016-176171038 CTTTGCTGGGGGTTGGTGGGGGG + Intronic
943798559 2:192029153-192029175 CTTTCTTAGGGGTTGGGGGAAGG + Intronic
944481389 2:200160996-200161018 CTGGATGGGGGGTCGGTGGAGGG + Intergenic
945830458 2:214778200-214778222 CTTTTTTGGGGGTGGGGGGAGGG - Intronic
945977540 2:216282471-216282493 CTCTCTGGGGTGGTGGTGGAGGG - Intronic
946156956 2:217813354-217813376 CAGTCTTGGGAGGTGGTGGGAGG - Intronic
946158825 2:217823705-217823727 CTGTCTTGCTGTTGGGTGGAGGG - Intronic
947732338 2:232438388-232438410 CTGTCTGGGGGAGGGGTGGAGGG - Intergenic
947855576 2:233321594-233321616 CAGGCTGGGGGGTTGGAGGATGG + Intronic
947898644 2:233699962-233699984 CTTTGTTGGGAGTTGGGGGACGG - Intronic
948202985 2:236143100-236143122 CTGTCTGTGGGTTTGGGGGAGGG + Intergenic
948307901 2:236963444-236963466 TTGTCTTGAGGGTTCGTGTAAGG - Intergenic
948560972 2:238851435-238851457 CTGGCTTGGAGGGTGGGGGAAGG + Intronic
948592392 2:239059823-239059845 CTGTCCTGCAGGCTGGTGGATGG - Intronic
1169187375 20:3630027-3630049 CCTTCTTGGAGGTTGGGGGATGG + Intronic
1169826707 20:9776732-9776754 GGGGCTTGGGGGTTGGTGGGAGG - Intronic
1170611638 20:17918531-17918553 GTGTGTTGTGGGTTGGAGGAAGG + Intergenic
1171142630 20:22756013-22756035 GTTTATTGGGGGTGGGTGGATGG + Intergenic
1172111501 20:32547990-32548012 TTGGGTTGGGGGTTGGGGGAAGG - Intronic
1173005322 20:39135650-39135672 TTGTCTTGAGGGGTTGTGGAAGG + Intergenic
1173025758 20:39305901-39305923 CTGTGCTGGGGGTGGGTGGGAGG + Intergenic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1175388484 20:58612001-58612023 CTGGCTTGCGGGTTGTTGGAAGG - Intergenic
1175673911 20:60930957-60930979 CTGTCCTGGGGGTTTGCAGAGGG - Intergenic
1175823580 20:61924675-61924697 CTGACATGGGAGTGGGTGGAGGG - Intronic
1175872233 20:62213973-62213995 CAGTGCTGGGGGTGGGTGGAGGG - Intergenic
1176233965 20:64045582-64045604 CTTGGTTGGGGGTTGGGGGAGGG + Intronic
1177659471 21:24064163-24064185 CTGTCAGGGGGGTTGGGGGCAGG + Intergenic
1178251879 21:31011007-31011029 CTGTATTGGGGTTGGGGGGAGGG - Intergenic
1179449829 21:41460838-41460860 CTGATTTGGGTGGTGGTGGAAGG - Intergenic
1179605967 21:42515093-42515115 CTTTGTTGGGGGTTGGAGGCAGG + Intronic
1180172380 21:46066337-46066359 CTGTGTTGGGGGCCGGGGGAAGG + Intergenic
1180787953 22:18557456-18557478 CTGTCTTGGCGTTAGCTGGAGGG - Intergenic
1181063755 22:20295543-20295565 CTGGGTTGAGGGTTGGGGGATGG + Intergenic
1181981466 22:26769717-26769739 CTGCCTTGGGGGTTGTTAGGAGG + Intergenic
1181987050 22:26807049-26807071 CTGTTGTAGGGCTTGGTGGAGGG + Intergenic
1182803817 22:33053727-33053749 CTGGTTTGGGGGTTGGCGGGTGG - Intronic
1183127643 22:35799962-35799984 CTTTTTTGGGGGGTGGGGGAAGG - Intronic
1183276971 22:36904565-36904587 CTGACTAGGGGGTTGCAGGAGGG + Intergenic
1183319659 22:37157266-37157288 CTGTCTTGGGGACTGGTGGGTGG - Intronic
1183450832 22:37894034-37894056 CTGAGATGGGGGTTGGTGGCTGG + Intergenic
1183464811 22:37974154-37974176 CTGTCTTCGGGGTGGTTGGAGGG + Exonic
1183601911 22:38844587-38844609 CAGTGTTGGGGGTTGGGGGGAGG + Intergenic
1183832816 22:40427841-40427863 CTTTCCTGGAGGTTGGTGGATGG - Intronic
1184157661 22:42678942-42678964 CTGTTTTGGGGTCTGGAGGATGG - Intergenic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1184980732 22:48094412-48094434 CTTTTTTGGGGGTGGGGGGAAGG - Intergenic
949358012 3:3202269-3202291 CTTTGTTGGGGGTCGGGGGAGGG + Intergenic
949864125 3:8533151-8533173 ATGCCTCGGGGTTTGGTGGATGG + Intronic
949864596 3:8537167-8537189 TTTTCCTGGGGGTGGGTGGATGG - Exonic
950681603 3:14588881-14588903 CTGTCTTGGAGGTCCCTGGATGG - Intergenic
950687590 3:14629593-14629615 TTGGCTTGGGGGTGGGTGCATGG - Intergenic
951618883 3:24579263-24579285 CTGTTTTTCTGGTTGGTGGAGGG + Intergenic
951628516 3:24693270-24693292 CTGTCTGGGGGGTGGGGGTAAGG - Intergenic
951697097 3:25456336-25456358 CTTTCTTGGGGGGTGGAGGAAGG + Intronic
953046874 3:39301357-39301379 GTGTGTTGGGGGGTGGAGGAAGG + Intergenic
953406909 3:42664219-42664241 CTCTCCTGGGGGTTGGGGGTGGG - Exonic
954134125 3:48574356-48574378 CTGTCTAGGGGGATGGTGGGTGG - Intronic
954305606 3:49723828-49723850 CTGTCAGGCGGGTTGGTGAAGGG - Exonic
954611425 3:51946480-51946502 CTGTCCTGGGCTTTGGTGGCGGG + Intronic
954876168 3:53804485-53804507 CTTTTCTGGGGGTTGGGGGAGGG - Intronic
955433964 3:58879732-58879754 GTGTCTTGGGGGTTGGTGGAGGG + Intronic
955667672 3:61367691-61367713 CTGTCATGGGGTTGGGGGGATGG + Intergenic
955965548 3:64385487-64385509 CTCTTCTGGGGGTTGATGGATGG - Intronic
956064968 3:65388417-65388439 CTGTCTTGGGGGGAGGGGGCAGG + Intronic
961008974 3:123423654-123423676 CTGCCTTGGGGCTTGGTGACGGG - Intronic
961453111 3:127011396-127011418 CTGCCTTGGGGGCTGTTGCAGGG + Intronic
961525558 3:127494801-127494823 ATGTCCTAGGGGTTTGTGGAAGG - Intergenic
962595893 3:136943029-136943051 CTGACTTGGGGTGTGGGGGATGG + Intronic
962833612 3:139166625-139166647 CTGTCATGGGGTGGGGTGGAGGG - Intronic
963363927 3:144310630-144310652 AAATCTTGGGGGTTGGGGGACGG - Intergenic
963734047 3:148999846-148999868 CTGACTATGGGGGTGGTGGAGGG - Intronic
964294607 3:155219719-155219741 CTGTTGTGGGGGATGGGGGAGGG - Intergenic
964822426 3:160786657-160786679 ATGTCATGGGGGTTGGTGTATGG + Intronic
964942563 3:162177127-162177149 CTGGGCTGGGGGTTGGGGGAGGG + Intergenic
965264032 3:166518123-166518145 CAGTGTTGGGGGCTGGGGGAGGG - Intergenic
965535379 3:169818229-169818251 CTGCTCTGGGGGTTGGAGGAGGG + Intergenic
965608898 3:170524399-170524421 CTGTGATGGGGGTAGGTGGCAGG + Intronic
965672321 3:171159291-171159313 CTGTCTTGGTGGCTGGGTGACGG + Intronic
965985501 3:174748155-174748177 CTGTCATGGGGGTGGAGGGAGGG + Intronic
966673082 3:182551487-182551509 CTGTCAGGGGGTTTGGGGGAGGG - Intergenic
966918427 3:184597423-184597445 CTGTCATGGGGGTTGGAGAGGGG - Intronic
967258905 3:187622414-187622436 CTGTCTAGGGAGATGGAGGATGG - Intergenic
967279162 3:187805648-187805670 CTGGCTTGGGGGATGGAGGAAGG + Intergenic
967493319 3:190117737-190117759 CTTTCTTGGGGGCTGGGGGAGGG + Intronic
967883739 3:194319272-194319294 ATGTCCTAGGGGTTTGTGGAAGG - Intergenic
967965614 3:194957861-194957883 CTGTCTTTGCAGTTGATGGAAGG + Intergenic
968255041 3:197262220-197262242 CTTTCCTGGAGGTTGGTGGGTGG - Intronic
968947538 4:3673333-3673355 CTGTCTTGGGTGCTGAAGGACGG + Intergenic
969442841 4:7227529-7227551 CTTTCTTGAGATTTGGTGGAAGG + Intronic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
970435268 4:16027565-16027587 CCCTCTTGGGGATGGGTGGAGGG - Intronic
970558454 4:17259272-17259294 CTGTTGTGGGGGTGGGGGGAGGG - Intergenic
971179615 4:24316935-24316957 CTGCCATGGGTGTAGGTGGAGGG + Intergenic
971236961 4:24850844-24850866 CTCTGGTGGGGGTTGGGGGAAGG + Intronic
971367599 4:25989947-25989969 CTGGCTTGTGGGTTGGTTTAGGG - Intergenic
971805948 4:31357775-31357797 CTTTCCTGGAGGTTGGTGGGTGG - Intergenic
971956002 4:33419238-33419260 TGGGCATGGGGGTTGGTGGATGG + Intergenic
972894752 4:43606421-43606443 CTGGCTGGGGGGTTGGGGGCTGG + Intergenic
973101294 4:46274618-46274640 ATATTTTGGGGGTTGTTGGAAGG + Intronic
973554302 4:52066653-52066675 CTCTGTTGGGGGTTGGGGGAAGG - Intronic
975020951 4:69487674-69487696 ATGTCTTGGGGTTTGTTGTATGG - Intronic
975186182 4:71406169-71406191 TTCTCTTGGGGGTTGGGGGAAGG - Intronic
975784981 4:77877898-77877920 CTGGCTGGGGGGTGGGGGGACGG + Intronic
976442653 4:85093412-85093434 CTTTCTTGAGAGTTGGAGGAGGG - Intergenic
976679423 4:87738782-87738804 GTGTGTTGGGTGTTGGGGGAAGG + Intergenic
976787637 4:88839823-88839845 TTGTCCTGGGGGGTGGAGGATGG + Intronic
976925397 4:90489668-90489690 CTGTCATGGGGTTGGGTGGAGGG - Intronic
978408717 4:108406320-108406342 ATGTCTTAGGGCTTTGTGGAAGG - Intergenic
981064271 4:140464629-140464651 CTGACTTGGGGGTGGAGGGATGG + Intronic
981517475 4:145625358-145625380 CAGTCCTGGGGGTTGGTGCTGGG + Intronic
981904895 4:149911369-149911391 CTGTCGTGGGGTTGGGGGGACGG - Intergenic
982126353 4:152187113-152187135 CTTTCTTGGGAGATGATGGAAGG + Intergenic
982181355 4:152751339-152751361 CTGGCTTGGGGGTTGGGGGTGGG - Intronic
982324901 4:154120113-154120135 CTGTCTTGTGGCTTGGCTGAGGG + Intergenic
982617586 4:157659679-157659701 CTGTCTGGGGGTGTGGGGGAAGG + Intergenic
982762103 4:159297234-159297256 TTTTTTTGGGGGTTGGGGGAAGG - Intronic
984505878 4:180618056-180618078 CTGTCTTGGGGGTTGGGGAAGGG - Intergenic
984767143 4:183408327-183408349 CTGTCTGGGGGAGTGGGGGACGG - Intergenic
984905492 4:184622110-184622132 GTCACCTGGGGGTTGGTGGAGGG - Intergenic
985614778 5:913060-913082 TTTTCTTGGGGGTTGGGGAAAGG + Intronic
985861106 5:2471336-2471358 CTGGCTGGGGGGTTGGGGGAAGG + Intergenic
985931027 5:3057987-3058009 CAGATTTGGGGTTTGGTGGAGGG + Intergenic
985935784 5:3096739-3096761 CTGTCTTGGTGCCTGGTGGGTGG - Intergenic
986100006 5:4599387-4599409 CTGTCTTGAGGATTAGTGTATGG - Intergenic
986403334 5:7400583-7400605 CTTCCTTGGGGGTTGAAGGATGG + Intronic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
987814561 5:22883624-22883646 GTGTCATGGGGGTTTGTGGTAGG - Intergenic
989958413 5:50381480-50381502 CTGTTTTGTGGGGTGGGGGAAGG + Intergenic
990521107 5:56582164-56582186 CTTTCTTGGGGGTTGGTGGAAGG - Intronic
990609277 5:57441323-57441345 TTGTCCTGGGGTTTGCTGGAAGG + Intergenic
991094698 5:62727571-62727593 CTGTGATGGGTGTTGGTGGAAGG - Intergenic
991774064 5:70067401-70067423 CTGGCATGGGGGGTGGTGGAGGG - Exonic
991853358 5:70942825-70942847 CTGGCATGGGGGGTGGTGGAGGG - Exonic
992091375 5:73320444-73320466 CTGTCTTGGGGTCTCTTGGAAGG - Intergenic
992950176 5:81850852-81850874 CTGTCGTGGGGGTGGGTGGACGG - Intergenic
992970287 5:82049392-82049414 CTGTTGTGGGGGTGGGGGGAGGG + Intronic
993519080 5:88876649-88876671 CTGTCTTCGGGGTTTGGGGAAGG + Intronic
993955532 5:94227816-94227838 CTGTCTCGGGGGTTGAGGGCTGG + Intronic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
995499006 5:112782411-112782433 CTGTTTTGGAGTATGGTGGAAGG + Intronic
996685674 5:126278198-126278220 CTGTTTTGGGGGTTGGGGTAGGG - Intergenic
998110115 5:139494912-139494934 CAGTCCTGGGGGTTGGTGCTGGG - Intergenic
998543160 5:143002375-143002397 CTGGGTTGGGGGTTGGGGGTTGG + Intronic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
999182518 5:149680303-149680325 CTCTCTTGGGGGTTGCTGTGAGG - Intergenic
999217415 5:149946914-149946936 CCTTCTTGGAGGTTGGAGGATGG - Intergenic
999588452 5:153117421-153117443 TTGTCATGGGGGTTGGTGGCAGG + Intergenic
1000153552 5:158527854-158527876 GTGTCTGGGGGGATTGTGGAAGG + Intergenic
1000616103 5:163428573-163428595 ATGAACTGGGGGTTGGTGGAGGG + Intergenic
1001834202 5:174817272-174817294 CTTCCTTGGGGGTTGGAGGGAGG - Intergenic
1002103009 5:176866620-176866642 CTGCCTTGGGGGTTAGGGGTGGG - Intronic
1002159395 5:177306284-177306306 CTGTACTGGGGGTGGGAGGAGGG + Intronic
1002358573 5:178651235-178651257 CAGTCATGGGGGTGGATGGAGGG + Intergenic
1003076504 6:2987910-2987932 AGGGCTTGGGGATTGGTGGATGG + Intergenic
1003188813 6:3855206-3855228 CTGTCTTGGAGGTTGGTGGGTGG - Intergenic
1004453767 6:15771895-15771917 GTGTCTTGGGGCATGGTGGGCGG + Intergenic
1005247788 6:23908608-23908630 CTGACTTGGGAGTGTGTGGATGG - Intergenic
1006127871 6:31851796-31851818 CTTTTTTGGGGGGTGGGGGAAGG - Intergenic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006300370 6:33190832-33190854 CTCCCTTGGGATTTGGTGGAGGG - Intronic
1006323267 6:33333585-33333607 CTGTCTGGGGGAGTGGGGGAAGG + Intergenic
1006401684 6:33821479-33821501 CTGGCCTGGGGGTGGGTGGCAGG - Intergenic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1007096695 6:39217714-39217736 CTGTCTTGGAGGTTGGCAGGGGG - Intronic
1007339565 6:41181887-41181909 CTGGCTTGGGGGTTAGGGGGAGG + Intergenic
1007787180 6:44287378-44287400 CTGTCTTGGCCCTGGGTGGAAGG + Intronic
1007932583 6:45705681-45705703 CTGTCTTGGGGTTGGAGGGAGGG + Intergenic
1008966291 6:57316405-57316427 CTGTCTCGGGTATTGGTGGTGGG + Intronic
1010204926 6:73314415-73314437 CTGTCTGTGGGGTGGGGGGACGG + Intergenic
1010444475 6:75935183-75935205 GTGCCTTGCGCGTTGGTGGAGGG + Intronic
1011101691 6:83729030-83729052 CTGTTGTGGGGGTTGGGGGGCGG + Intergenic
1011494395 6:87924382-87924404 CTGTTTTGGGGGATGTTAGAAGG - Intergenic
1013896697 6:115097400-115097422 CTGTCTGGGGTGATGGGGGAAGG - Intergenic
1014851368 6:126343389-126343411 CTGTATTGGGGTTTGCTAGAGGG + Intronic
1015450003 6:133356006-133356028 CTGTCTTGGGGGTTAGGGGTGGG + Intronic
1015497065 6:133893184-133893206 CGGCCTGTGGGGTTGGTGGAAGG - Exonic
1018014373 6:159698926-159698948 CTGTCTGGGGGGTGGGGGGCGGG + Intronic
1018242663 6:161793683-161793705 CTATCTCTGGGGTTGGAGGAAGG + Intronic
1019365832 7:632388-632410 CTGTGTTGGGGGGCAGTGGATGG - Intronic
1019565382 7:1676343-1676365 CTGTCCTGTGGAATGGTGGAAGG + Intergenic
1019886694 7:3911727-3911749 CTGTATTAGGTGTTGGAGGAGGG + Intronic
1020635750 7:10693981-10694003 CTGTCATGGGGTTAGGGGGATGG + Intergenic
1021585435 7:22202614-22202636 CTGGCTTGCGGCTTGGTGGAAGG - Intronic
1021708978 7:23396247-23396269 CTGGCTTGGGGGTAGGGGGCAGG + Intronic
1021802893 7:24325578-24325600 CTTTTTTGGGGGTGGGTGGGTGG - Intergenic
1022192630 7:28031724-28031746 CAGTCATGGGGGTTGGGGGAAGG + Intronic
1022532675 7:31076733-31076755 CTGCCTTGGGAGTAGGTGGGGGG + Intronic
1023862255 7:44223742-44223764 CTGGCTTGGGGGCTGCTGGAAGG - Intronic
1024056708 7:45664089-45664111 CTCCCCTGGGGGCTGGTGGAGGG + Intronic
1025839847 7:65136188-65136210 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1025883219 7:65559777-65559799 CTGTCTTGGGGTGGGGTGGGGGG + Intergenic
1025890227 7:65642829-65642851 CTGTCTTGGGGTGGGGTGGGGGG - Intergenic
1026166728 7:67916692-67916714 TTGACGTGGGGGTTGGGGGATGG - Intergenic
1026505741 7:70981057-70981079 CTGTCTTGGGGGCAGGAGCAGGG - Intergenic
1027230431 7:76268787-76268809 CTGTCTTGGGAGGGGGTTGAGGG + Intronic
1027696767 7:81421670-81421692 CTGTTTTTGGGGTGGGGGGAGGG - Intergenic
1028194959 7:87895535-87895557 CTGTCTTGGTGGTTGTGGGTGGG + Intronic
1028351098 7:89849692-89849714 ATGTCTTGGGTGTAGGTGGGTGG + Intergenic
1028433111 7:90771088-90771110 CAGGCTGGGGGATTGGTGGATGG - Intronic
1029545033 7:101206200-101206222 CCGTCCTGGGAGTTGGGGGATGG - Exonic
1029646292 7:101858290-101858312 CTGGTTTTGGGGTTGGTGGTGGG + Intronic
1030826850 7:114169181-114169203 CTGTTCTGGGGGCTGGAGGACGG - Intronic
1030970674 7:116051141-116051163 CTGTCTTGGGGTTGGGGGAAGGG + Intronic
1033447620 7:141436524-141436546 CTGTGGTGGGTGTTGGTGAAGGG + Intronic
1034075367 7:148226365-148226387 CATTCTTGGTGGTTGGTGGGAGG - Intronic
1034493684 7:151407943-151407965 CTGTCTTGGGGGTAGAGGGGTGG - Intronic
1035074630 7:156169554-156169576 TTGTCCCGGGGGTAGGTGGAGGG + Intergenic
1036633208 8:10529832-10529854 CAGGCTGGGGGGTGGGTGGATGG - Intronic
1037069508 8:14626302-14626324 CTGTTGAGGGGGTTGGGGGAGGG - Intronic
1037575489 8:20198059-20198081 GTGGCTTGGTGTTTGGTGGAGGG + Intronic
1037690155 8:21174827-21174849 CTATCTTGGAGGGTGGTTGAGGG + Intergenic
1038329454 8:26596647-26596669 CTATCTTCGGGGTTGATGGAAGG - Intronic
1038494259 8:27990467-27990489 CTGTGTTGGGGGTAGGCTGATGG + Intronic
1038608222 8:29032264-29032286 CTTTTTTGGGGGTGGGAGGAGGG + Intronic
1039186534 8:34923536-34923558 CTTTTTTGGGGGTTGGGGGGGGG - Intergenic
1040798283 8:51312233-51312255 TTGGCGTGGGGGTTGGGGGAGGG + Intergenic
1040900978 8:52416875-52416897 CTGCCTTGGGGTCTGGTGGGAGG + Intronic
1041418701 8:57643192-57643214 CTTTTTTGGGGGTTGGGGGGTGG + Intergenic
1041491447 8:58437952-58437974 CTGTGATGGGGGTTGGGGGGGGG - Intronic
1042281019 8:67055859-67055881 ATGTCTTGGGGGTGGGGGGAGGG + Intronic
1044116560 8:88343169-88343191 CTGTCAAGGGGGGTGGTGGGGGG - Intergenic
1044434930 8:92150821-92150843 CTGTCTGGGGTGGGGGTGGAGGG + Intergenic
1044448655 8:92308512-92308534 CTGTCTTGGTGTGTGGGGGATGG - Intergenic
1045763905 8:105644730-105644752 CTCTCTTCTGGGTTTGTGGATGG + Intronic
1045824978 8:106386629-106386651 TTGACTTAGGGGTTGGAGGAGGG - Intronic
1047350813 8:124071799-124071821 CTCTCTTGCTGGTTTGTGGATGG + Intronic
1047641329 8:126824686-126824708 ATTGCTTGGGGGTGGGTGGAGGG + Intergenic
1047677339 8:127217228-127217250 CAATTTTGGGGGTTGGTGGGAGG + Intergenic
1048205618 8:132412934-132412956 ATGTGTTGGGAGGTGGTGGATGG - Intronic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1049703882 8:144029046-144029068 CTGTCGGAGGGGTTGGGGGAGGG + Intronic
1050286323 9:4106107-4106129 TTGTCTAAGGTGTTGGTGGAAGG - Intronic
1050563733 9:6860543-6860565 ATGTCATGGGGGTTGGTTGTAGG - Intronic
1051657542 9:19397318-19397340 CGGAGTTGGGGGTTGGGGGAAGG + Intergenic
1052165366 9:25319786-25319808 CTGTCAGGGGGGTGGGGGGAGGG - Intergenic
1053641027 9:40080252-40080274 CTGGCAGGGGGGTTGGGGGATGG + Intergenic
1053765109 9:41385216-41385238 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1054543725 9:66296378-66296400 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1056480984 9:87005882-87005904 GTATCTTGGGGGTGTGTGGAGGG - Intergenic
1056541003 9:87571420-87571442 GTGTGTTGGGGGGTGGGGGATGG - Intronic
1056561984 9:87738550-87738572 CTGTCAGGGGGGTGGGAGGAGGG + Intergenic
1057157273 9:92853980-92854002 CTGTCTTGGGAGTTTATGGCAGG + Intronic
1057594032 9:96399331-96399353 CTTTTTTGGGGGATGGTGGAGGG + Intronic
1058149112 9:101444584-101444606 ATGCCTTTGGGGTTGGAGGAGGG - Intergenic
1059306948 9:113361148-113361170 CAGGGTTGGGGGTTAGTGGATGG - Intronic
1060943187 9:127555267-127555289 CTGTCCTGTGTATTGGTGGAGGG + Intronic
1061231395 9:129317949-129317971 GTCTCCTGGGGGCTGGTGGAGGG - Intergenic
1061575474 9:131503338-131503360 CAGCCTCGGGAGTTGGTGGACGG + Intronic
1061643566 9:131980072-131980094 ATTTCTTGGGGGATGGGGGAAGG + Intronic
1061862097 9:133473362-133473384 CTGTCTTGGGTGTTAAGGGATGG - Intronic
1061894850 9:133641867-133641889 GTGACCTTGGGGTTGGTGGAGGG + Intronic
1062132719 9:134908626-134908648 CTGGCTTTGGGGTTGGGGGAAGG + Intronic
1062264386 9:135680003-135680025 CTGACCTGGGGGTAGGGGGAGGG - Intergenic
1062676576 9:137749097-137749119 CTGTCCTGGGGGTGGGTAGCAGG - Intronic
1062676590 9:137749148-137749170 CTGTCCTGGGGGTGGGTAGCAGG - Intronic
1187993143 X:24897363-24897385 CTGAGGTGGGGGTTGGTGGGGGG - Intronic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1189106826 X:38245159-38245181 CTCCCTTGGGGAATGGTGGAGGG + Intronic
1189222207 X:39382162-39382184 ATGTCCTGGGAGTTTGTGGAGGG + Intergenic
1190518569 X:51251360-51251382 GTGTGTTGGGGGTCGGGGGAGGG - Intergenic
1191256881 X:58283327-58283349 CTGGCATGGGGGTTGTTGGGAGG + Intergenic
1192326294 X:70134874-70134896 CTTTCTTGGCGGGTGGTGGGGGG + Intronic
1192722696 X:73716400-73716422 CTGTCTTGGGAGGTGGTGGGGGG - Intergenic
1195212247 X:102660966-102660988 CTGTCTTGGGCCTTAGAGGAGGG + Intergenic
1195792824 X:108607486-108607508 CTGTCTTGGGGTATGGGGGGAGG - Intronic
1196140978 X:112263047-112263069 CTGTTTTGGGGTTGGGGGGAGGG + Intergenic
1196843982 X:119883892-119883914 GAGTCTTTGGGGTTGGAGGAAGG - Intergenic
1197115202 X:122823828-122823850 GTCTGTTGGGGGTGGGTGGAAGG + Intergenic
1197322255 X:125046884-125046906 GTGTTTTGGGGGTTGGGGTAAGG + Intergenic
1198803429 X:140470547-140470569 CTTTCTTGGGGGTGGGTCCAGGG + Intergenic
1198862282 X:141084178-141084200 CGGCCTTCGGCGTTGGTGGACGG - Intergenic
1198862302 X:141084250-141084272 CGGCCTTCGGCGTTGGTGGACGG - Intergenic
1198900388 X:141503122-141503144 CGGCCTTCGGCGTTGGTGGACGG + Intergenic
1198900408 X:141503194-141503216 CGGCCTTCGGCGTTGGTGGACGG + Intergenic
1199408425 X:147490845-147490867 GTGGGGTGGGGGTTGGTGGAGGG - Intergenic
1199550163 X:149052175-149052197 CTGTCCTGAGGGTGGGGGGAGGG + Intergenic
1199845751 X:151692099-151692121 CTCTCTTGGTGGCTTGTGGATGG + Intergenic
1199858642 X:151780394-151780416 CTGGATTGGGGGTTGGGAGAGGG - Intergenic
1200034302 X:153318247-153318269 CAGTCCTGGGAGATGGTGGAAGG - Intergenic
1200788187 Y:7276773-7276795 CTTTTTGGGGGGTGGGTGGAGGG + Intergenic
1200909338 Y:8516541-8516563 TGGTCTTGTGGGTCGGTGGAGGG + Intergenic
1201554369 Y:15253556-15253578 CTGTGTTGTGGGCTGGTGGTGGG - Intergenic
1201570827 Y:15412104-15412126 CTGTTGTGGGGGTTGGGGGAAGG + Intergenic
1201572733 Y:15431902-15431924 CTGTTGTGGGAGTTGGGGGAGGG + Intergenic