ID: 1175220676

View in Genome Browser
Species Human (GRCh38)
Location 20:57414761-57414783
Sequence GTGGGGAGACTGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175220676_1175220680 -9 Left 1175220676 20:57414761-57414783 CCCTCCTGCTTCAGTCTCCCCAC No data
Right 1175220680 20:57414775-57414797 TCTCCCCACCTCTGGAACCGAGG No data
1175220676_1175220687 25 Left 1175220676 20:57414761-57414783 CCCTCCTGCTTCAGTCTCCCCAC No data
Right 1175220687 20:57414809-57414831 GCCCCAGAATGCATGAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175220676 Original CRISPR GTGGGGAGACTGAAGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr