ID: 1175223896

View in Genome Browser
Species Human (GRCh38)
Location 20:57433751-57433773
Sequence GAGCCAGTCAAGCTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175223891_1175223896 1 Left 1175223891 20:57433727-57433749 CCAGGGCTCTTGTGCCTGGTGTG No data
Right 1175223896 20:57433751-57433773 GAGCCAGTCAAGCTGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175223896 Original CRISPR GAGCCAGTCAAGCTGGAGAC AGG Intergenic
No off target data available for this crispr