ID: 1175224392

View in Genome Browser
Species Human (GRCh38)
Location 20:57436465-57436487
Sequence AGATGGAGCGGGGGGTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175224392_1175224406 15 Left 1175224392 20:57436465-57436487 CCTGCTTACCCCCCGCTCCATCT No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224392_1175224404 12 Left 1175224392 20:57436465-57436487 CCTGCTTACCCCCCGCTCCATCT No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224392_1175224401 2 Left 1175224392 20:57436465-57436487 CCTGCTTACCCCCCGCTCCATCT No data
Right 1175224401 20:57436490-57436512 GAGAGCAGGCCCCAGGCTCCTGG No data
1175224392_1175224400 -5 Left 1175224392 20:57436465-57436487 CCTGCTTACCCCCCGCTCCATCT No data
Right 1175224400 20:57436483-57436505 CATCTGAGAGAGCAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175224392 Original CRISPR AGATGGAGCGGGGGGTAAGC AGG (reversed) Intergenic
No off target data available for this crispr