ID: 1175224398

View in Genome Browser
Species Human (GRCh38)
Location 20:57436477-57436499
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175224398_1175224404 0 Left 1175224398 20:57436477-57436499 CCGCTCCATCTGAGAGAGCAGGC No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224398_1175224401 -10 Left 1175224398 20:57436477-57436499 CCGCTCCATCTGAGAGAGCAGGC No data
Right 1175224401 20:57436490-57436512 GAGAGCAGGCCCCAGGCTCCTGG No data
1175224398_1175224406 3 Left 1175224398 20:57436477-57436499 CCGCTCCATCTGAGAGAGCAGGC No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175224398 Original CRISPR GCCTGCTCTCTCAGATGGAG CGG (reversed) Intergenic
No off target data available for this crispr