ID: 1175224399

View in Genome Browser
Species Human (GRCh38)
Location 20:57436482-57436504
Sequence CTGGGGCCTGCTCTCTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175224399_1175224406 -2 Left 1175224399 20:57436482-57436504 CCATCTGAGAGAGCAGGCCCCAG No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224399_1175224404 -5 Left 1175224399 20:57436482-57436504 CCATCTGAGAGAGCAGGCCCCAG No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175224399 Original CRISPR CTGGGGCCTGCTCTCTCAGA TGG (reversed) Intergenic
No off target data available for this crispr