ID: 1175224400

View in Genome Browser
Species Human (GRCh38)
Location 20:57436483-57436505
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175224391_1175224400 1 Left 1175224391 20:57436459-57436481 CCAACTCCTGCTTACCCCCCGCT No data
Right 1175224400 20:57436483-57436505 CATCTGAGAGAGCAGGCCCCAGG No data
1175224392_1175224400 -5 Left 1175224392 20:57436465-57436487 CCTGCTTACCCCCCGCTCCATCT No data
Right 1175224400 20:57436483-57436505 CATCTGAGAGAGCAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175224400 Original CRISPR CATCTGAGAGAGCAGGCCCC AGG Intergenic
No off target data available for this crispr