ID: 1175224404

View in Genome Browser
Species Human (GRCh38)
Location 20:57436500-57436522
Sequence CCCAGGCTCCTGGCGTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175224399_1175224404 -5 Left 1175224399 20:57436482-57436504 CCATCTGAGAGAGCAGGCCCCAG No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224396_1175224404 1 Left 1175224396 20:57436476-57436498 CCCGCTCCATCTGAGAGAGCAGG No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224398_1175224404 0 Left 1175224398 20:57436477-57436499 CCGCTCCATCTGAGAGAGCAGGC No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224392_1175224404 12 Left 1175224392 20:57436465-57436487 CCTGCTTACCCCCCGCTCCATCT No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224395_1175224404 2 Left 1175224395 20:57436475-57436497 CCCCGCTCCATCTGAGAGAGCAG No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224394_1175224404 3 Left 1175224394 20:57436474-57436496 CCCCCGCTCCATCTGAGAGAGCA No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224391_1175224404 18 Left 1175224391 20:57436459-57436481 CCAACTCCTGCTTACCCCCCGCT No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data
1175224393_1175224404 4 Left 1175224393 20:57436473-57436495 CCCCCCGCTCCATCTGAGAGAGC No data
Right 1175224404 20:57436500-57436522 CCCAGGCTCCTGGCGTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175224404 Original CRISPR CCCAGGCTCCTGGCGTGTGC AGG Intergenic
No off target data available for this crispr