ID: 1175224406

View in Genome Browser
Species Human (GRCh38)
Location 20:57436503-57436525
Sequence AGGCTCCTGGCGTGTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175224396_1175224406 4 Left 1175224396 20:57436476-57436498 CCCGCTCCATCTGAGAGAGCAGG No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224391_1175224406 21 Left 1175224391 20:57436459-57436481 CCAACTCCTGCTTACCCCCCGCT No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224393_1175224406 7 Left 1175224393 20:57436473-57436495 CCCCCCGCTCCATCTGAGAGAGC No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224399_1175224406 -2 Left 1175224399 20:57436482-57436504 CCATCTGAGAGAGCAGGCCCCAG No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224395_1175224406 5 Left 1175224395 20:57436475-57436497 CCCCGCTCCATCTGAGAGAGCAG No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224394_1175224406 6 Left 1175224394 20:57436474-57436496 CCCCCGCTCCATCTGAGAGAGCA No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224398_1175224406 3 Left 1175224398 20:57436477-57436499 CCGCTCCATCTGAGAGAGCAGGC No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data
1175224392_1175224406 15 Left 1175224392 20:57436465-57436487 CCTGCTTACCCCCCGCTCCATCT No data
Right 1175224406 20:57436503-57436525 AGGCTCCTGGCGTGTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175224406 Original CRISPR AGGCTCCTGGCGTGTGCAGG TGG Intergenic
No off target data available for this crispr