ID: 1175225107

View in Genome Browser
Species Human (GRCh38)
Location 20:57440039-57440061
Sequence TATTCTGAGCAGCGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175225107_1175225110 2 Left 1175225107 20:57440039-57440061 CCAGCTTCCCGCTGCTCAGAATA No data
Right 1175225110 20:57440064-57440086 ATGTGACACCCCACAGACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175225107 Original CRISPR TATTCTGAGCAGCGGGAAGC TGG (reversed) Intergenic
No off target data available for this crispr