ID: 1175228617

View in Genome Browser
Species Human (GRCh38)
Location 20:57459859-57459881
Sequence CCTGGGGAGACCGTTTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175228605_1175228617 22 Left 1175228605 20:57459814-57459836 CCAAGACTGGGAAGGGAAGGGGA No data
Right 1175228617 20:57459859-57459881 CCTGGGGAGACCGTTTCCCTAGG No data
1175228603_1175228617 23 Left 1175228603 20:57459813-57459835 CCCAAGACTGGGAAGGGAAGGGG No data
Right 1175228617 20:57459859-57459881 CCTGGGGAGACCGTTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175228617 Original CRISPR CCTGGGGAGACCGTTTCCCT AGG Intergenic
No off target data available for this crispr