ID: 1175230061

View in Genome Browser
Species Human (GRCh38)
Location 20:57468102-57468124
Sequence TTTCTAGGAGCCGCTGCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175230061_1175230064 -9 Left 1175230061 20:57468102-57468124 CCCGGGGCAGCGGCTCCTAGAAA No data
Right 1175230064 20:57468116-57468138 TCCTAGAAACACTGGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175230061 Original CRISPR TTTCTAGGAGCCGCTGCCCC GGG (reversed) Intergenic
No off target data available for this crispr