ID: 1175232203

View in Genome Browser
Species Human (GRCh38)
Location 20:57481175-57481197
Sequence CTGTTTCAGCATTCTGTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175232203_1175232210 16 Left 1175232203 20:57481175-57481197 CCTCCGACAGAATGCTGAAACAG No data
Right 1175232210 20:57481214-57481236 AGGAGCTTCTGAGGTTGTGGCGG No data
1175232203_1175232206 -4 Left 1175232203 20:57481175-57481197 CCTCCGACAGAATGCTGAAACAG No data
Right 1175232206 20:57481194-57481216 ACAGGATTGCACAGTTGACCAGG No data
1175232203_1175232208 13 Left 1175232203 20:57481175-57481197 CCTCCGACAGAATGCTGAAACAG No data
Right 1175232208 20:57481211-57481233 ACCAGGAGCTTCTGAGGTTGTGG No data
1175232203_1175232207 7 Left 1175232203 20:57481175-57481197 CCTCCGACAGAATGCTGAAACAG No data
Right 1175232207 20:57481205-57481227 CAGTTGACCAGGAGCTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175232203 Original CRISPR CTGTTTCAGCATTCTGTCGG AGG (reversed) Intergenic
No off target data available for this crispr