ID: 1175234891

View in Genome Browser
Species Human (GRCh38)
Location 20:57503026-57503048
Sequence CCCCTAGGTCCCCCGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175234881_1175234891 7 Left 1175234881 20:57502996-57503018 CCAGAGTTGCAAGAGGCTAGGAG No data
Right 1175234891 20:57503026-57503048 CCCCTAGGTCCCCCGAGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 141
1175234879_1175234891 10 Left 1175234879 20:57502993-57503015 CCACCAGAGTTGCAAGAGGCTAG 0: 1
1: 0
2: 0
3: 20
4: 142
Right 1175234891 20:57503026-57503048 CCCCTAGGTCCCCCGAGGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175234891 Original CRISPR CCCCTAGGTCCCCCGAGGGA GGG Intronic
900168762 1:1255902-1255924 CCCCCAGGAGCCCCGAGGCAGGG - Intronic
900478657 1:2887864-2887886 CCCCTGTGTGCCCCTAGGGAGGG + Intergenic
900778796 1:4603830-4603852 CCCCTAGATCCTCCGATGGAAGG - Intergenic
900910659 1:5594806-5594828 CCCCCAGGCCCCACCAGGGAGGG + Intergenic
900915401 1:5634960-5634982 CCCAGAGGCCCCCAGAGGGATGG - Intergenic
900994213 1:6111716-6111738 CCCCGAGGTCCACGGAGGAACGG + Intronic
905125899 1:35716082-35716104 CCCCTGGATCCCCTGAGGAAGGG - Exonic
905906428 1:41621417-41621439 CCCCTCTGTCTCCCAAGGGAGGG + Intronic
913961332 1:143339957-143339979 CCCCTAGGACACACAAGGGAAGG - Intergenic
914055685 1:144165530-144165552 CCCCTAGGACACACAAGGGAAGG - Intergenic
914086965 1:144462024-144462046 CCCCCAGCTCCCCCGAGAGGTGG + Intergenic
914123461 1:144800832-144800854 CCCCTAGGACACACAAGGGAAGG + Intergenic
914311645 1:146472189-146472211 CCCCCAGCTCCCCCGAGAGGTGG - Intergenic
914377085 1:147080852-147080874 CCCCAAGGCCCCTCGAAGGAAGG - Intergenic
914590769 1:149103916-149103938 CCCCCAGCTCCCCCGAGAGGTGG + Intergenic
915141945 1:153773378-153773400 CCCCAAGCTCCCCCGGTGGAAGG + Exonic
915396711 1:155590625-155590647 CTCAGAGGTCCCCCGAGAGATGG + Intergenic
915490255 1:156246674-156246696 CCACCAGGTCCCCCGGGTGAGGG - Exonic
915534231 1:156525195-156525217 CCTCTCTGTCCCCCGGGGGAAGG + Intergenic
915558452 1:156673162-156673184 TCCCTAGGACCCCAGAGGGCCGG - Exonic
919482583 1:198108098-198108120 CCCCTTGGTCACCCCAGTGATGG + Intergenic
922556528 1:226536767-226536789 CCCAGAGGGCCCCCCAGGGAAGG + Intergenic
923894737 1:238257460-238257482 CCCCAAGGTCACACCAGGGACGG - Intergenic
1063170835 10:3508603-3508625 CCTCTAGGTCCCCAGAAAGAAGG + Intergenic
1070606462 10:77901789-77901811 GCCCAAGGTCCCCCTGGGGAAGG + Intronic
1073704468 10:105967457-105967479 CCCCTAGAGCCCCACAGGGAGGG + Intergenic
1074839470 10:117334881-117334903 CCCATAGGTCCCCTGAGGTTTGG - Intronic
1075048144 10:119162339-119162361 CCCTTTGGTCCGCCGAGGCAGGG + Exonic
1075787728 10:125061407-125061429 CCCCTAGCTGCCCCAGGGGAAGG + Intronic
1075800418 10:125150204-125150226 CCCCCATCTCCCTCGAGGGAGGG - Intronic
1076611713 10:131730111-131730133 CCTCCAGGTCCTCTGAGGGATGG + Intergenic
1080642298 11:34165018-34165040 TCCCTGGGTCTCCAGAGGGAAGG + Intronic
1083262590 11:61531290-61531312 CCCCTTGCTGCCCCCAGGGAAGG - Intronic
1083747793 11:64745055-64745077 CCACTAGCTGCCCCGAGGGCGGG + Intronic
1084166869 11:67379202-67379224 CCACTGGGGCCCCCGAGGGCAGG + Intronic
1087166690 11:95012181-95012203 CCCCTAGGGCCACTGAAGGACGG - Intergenic
1088810293 11:113387576-113387598 TCCCCAGTTCCCCCTAGGGAGGG - Intergenic
1089656245 11:119948872-119948894 CCCCTAGTTCCCCCAAGGCCAGG + Intergenic
1092252052 12:6905018-6905040 GCCCTTGGTCCCGAGAGGGAAGG - Exonic
1094408900 12:30148847-30148869 GCCATAGGTCCCCTTAGGGAAGG - Intergenic
1094833668 12:34312290-34312312 GTCCTAGGTCCCCCCAGGAATGG - Intergenic
1103905296 12:124324571-124324593 CCCCTTGGTCCTGCGAGTGATGG + Exonic
1104019541 12:124982454-124982476 CCTCCAGGGCCCCCTAGGGAGGG - Intronic
1104823770 12:131694082-131694104 CCCCTATGACCCCCAAGGTAGGG + Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1120751527 14:88202913-88202935 CTCCTAGGTCCTCCGACAGAGGG + Intronic
1123118930 14:105908186-105908208 CTCCTAGGGCCCCTGAGGGATGG - Intergenic
1125794963 15:42397295-42397317 CCCCTAAGTTCCCCGAGGACTGG + Intronic
1127760896 15:62138090-62138112 CCCCTAGGTCACCTCAAGGAAGG - Intergenic
1128735763 15:70053161-70053183 CCACTGGGGCCCCGGAGGGAGGG + Intronic
1132353951 15:101157891-101157913 CCCCCAGGTCCCCAGAGGCGTGG + Intergenic
1132645448 16:997364-997386 CTCCCTGGGCCCCCGAGGGAGGG + Intergenic
1133000669 16:2849973-2849995 CCAGCAGGACCCCCGAGGGAAGG + Intergenic
1133294844 16:4746663-4746685 CCCCTGGGTCCCTGCAGGGAGGG + Intronic
1136323384 16:29502510-29502532 CTCCTGGGTCCCCAGGGGGAAGG + Intronic
1136438069 16:30242479-30242501 CTCCTGGGTCCCCAGGGGGAAGG + Intronic
1136927401 16:34388116-34388138 CCCCAGGGTACCCAGAGGGATGG + Intergenic
1136977173 16:35023690-35023712 CCCCAGGGTACCCAGAGGGATGG - Exonic
1141169677 16:81683358-81683380 CCCTGAAGTTCCCCGAGGGAGGG - Intronic
1141656972 16:85421706-85421728 GCCCTTGGTTCCCCGAGGGAAGG - Intergenic
1142262788 16:89050546-89050568 CCCCTGGGGCCCTCGAGGGAGGG + Intergenic
1142667729 17:1472094-1472116 CCCCGAAGTCCCCCGTGGGAGGG + Intronic
1144840739 17:18184150-18184172 CCCCGGGGCCCCCGGAGGGAGGG - Intronic
1146952040 17:36913486-36913508 CCCCTGGCTCTCCCTAGGGAGGG + Intergenic
1147213485 17:38885767-38885789 CCCCTAGATCCCAGCAGGGATGG - Intronic
1147539720 17:41347000-41347022 CCCCCAGGGCCCCGGAGGCAGGG - Intronic
1147541669 17:41365331-41365353 CCCCCAGGGCCCCGGAGGCAGGG - Intronic
1147545143 17:41395401-41395423 CCCCCAGGGCCCCGGAGGCAGGG - Intronic
1148677035 17:49451606-49451628 CCCCAAGGGCCCCCAAGGGCAGG + Intronic
1148693348 17:49545406-49545428 ACCCCAGGACCCCCCAGGGAAGG + Intergenic
1152587877 17:81197135-81197157 CCCCTCTGTCCCCAGAGGGCAGG - Intronic
1154119068 18:11636363-11636385 CTCCTGGGTCCCCAGAGGGCAGG + Intergenic
1154199138 18:12287447-12287469 CCCCACGCTCCCCCGAGTGATGG + Intergenic
1155009477 18:21761600-21761622 CACCCAGGTCCACTGAGGGAGGG - Intronic
1157587840 18:48816685-48816707 TGCCTAGGCCCCTCGAGGGACGG + Intronic
1161039612 19:2103265-2103287 CACCTGGGTCTCCCGTGGGAGGG + Intronic
1161228903 19:3162739-3162761 CCCCTGGGTCCAAAGAGGGAGGG + Intronic
1161962191 19:7529041-7529063 CCCCCAGGCCCCCCAAAGGAAGG + Intronic
1162138569 19:8571362-8571384 CCCCCTGCTCCCCTGAGGGATGG - Intronic
1166054028 19:40277985-40278007 CCCCTGGGCCCCCCTTGGGAGGG + Intronic
1166932265 19:46308492-46308514 CCCCTTGGACCCCCCAGGGCAGG - Intronic
1168144924 19:54415537-54415559 CCCCCATGGCCCCCGGGGGAGGG - Exonic
1202695168 1_KI270712v1_random:118207-118229 CCCCTAGGACACACAAGGGAAGG - Intergenic
926115407 2:10210055-10210077 GCCCTTGTTCACCCGAGGGAGGG - Intronic
926149294 2:10415749-10415771 CCCCAAGGTCCCCCGAGCAGGGG + Intronic
927495741 2:23550370-23550392 CCCCCAGGTCCCACTAGAGATGG + Intronic
928370286 2:30735594-30735616 CCCCTGGGTCCCCCGGGGCAAGG - Intronic
941666542 2:168247907-168247929 CCCCTGGGGACCCCGAGGGCGGG + Exonic
947793625 2:232881109-232881131 CCCCTGGGGGCCCCGAGGGGAGG + Intronic
948013594 2:234670016-234670038 CCCTTAGGTCCCCATAGGAAAGG - Intergenic
1169506792 20:6220088-6220110 CCCCTAGTTCTTCAGAGGGAAGG + Intergenic
1169854707 20:10090134-10090156 CCCCTAGGTCTCTCTAGGAAAGG + Intergenic
1173182537 20:40815786-40815808 CCCCTACTTCCCCCCAGGCAGGG + Intergenic
1173868765 20:46329134-46329156 CAAATATGTCCCCCGAGGGAGGG - Intergenic
1175142844 20:56873541-56873563 CACCTAGGGCCCCAGAGGGCAGG - Intergenic
1175234891 20:57503026-57503048 CCCCTAGGTCCCCCGAGGGAGGG + Intronic
1181088672 22:20457359-20457381 CCTCTAGGTCCCCTGAAGGGTGG - Intronic
1181931850 22:26408264-26408286 CCCTGGGGTCCCCAGAGGGATGG - Intergenic
1183541017 22:38429517-38429539 CCCGTAGGTCCCATGAGGTAGGG - Intronic
1184495580 22:44839273-44839295 CCCCGAGGTGCCCTGAGGGCTGG - Intronic
950424880 3:12919752-12919774 CCCCAGGGTCCCCGGAAGGAAGG - Intronic
952511766 3:34065574-34065596 TCCCTAGGTCCCTGGAGTGATGG - Intergenic
953145507 3:40270962-40270984 CTCCTTGGTCCCCTGAGGTATGG - Intergenic
954630673 3:52046188-52046210 CCTCTGGGTGCCCCGATGGAGGG - Intergenic
954789715 3:53123180-53123202 CAGCTAGGTCCCCACAGGGAGGG - Intronic
954812753 3:53257991-53258013 CTCCTAGGTCCCCAGAGCCATGG - Intergenic
959739069 3:109695220-109695242 CCCATAGGTCCCCCGATGGCAGG + Intergenic
961792851 3:129389087-129389109 CCCCTAGGTTCCCGCTGGGAAGG - Intergenic
961806770 3:129495279-129495301 CCCCTAGGTTCCCGCTGGGAAGG - Intronic
968947512 4:3673205-3673227 CCCCCAGATCCCCTGTGGGATGG - Intergenic
972338902 4:38133623-38133645 CAGCTAGGTCCACAGAGGGATGG + Intronic
985496346 5:208662-208684 CCCCATGGGCCCCCGAGGAAAGG - Intronic
985575412 5:671367-671389 CCCCTGGGGCCCCCTAGAGAAGG - Intronic
986024960 5:3842081-3842103 CCCCCAGTTCCCCAGAAGGAAGG - Intergenic
992623285 5:78614344-78614366 CCACTAGGTCCCCAAAGGGTGGG + Intronic
995782892 5:115796833-115796855 CCGCTATGTCCCCAGAGGGCAGG + Intergenic
998770327 5:145536628-145536650 CCCCTATGGACTCCGAGGGAGGG - Intronic
1001580609 5:172795628-172795650 TCCCTAGCTTCCCCTAGGGATGG + Intergenic
1002001175 5:176196999-176197021 CCCCGAGGTCCCACAAGGGGAGG + Intergenic
1002682863 5:180981840-180981862 CCCCTGGGTCCCCCGAGGACCGG + Intergenic
1002898382 6:1392007-1392029 GCCCTAGGTGCTCCGAGCGAGGG - Intronic
1006459185 6:34148477-34148499 CCCCTAGCTCCCCCAGGGCAGGG - Intronic
1007113739 6:39328760-39328782 CCCAGAGGTCCCCAGCGGGATGG - Intergenic
1007211212 6:40194650-40194672 CCCCTAGGTCCCCTTCAGGAAGG - Intergenic
1014056852 6:117025725-117025747 CCCCTAGGTCCTCCTGGGGCAGG + Intergenic
1015058901 6:128938590-128938612 TGCCTAGGTCCCATGAGGGAAGG + Intronic
1019363958 7:621731-621753 CCCCTGGGTCCCTCCAGGCAAGG - Intronic
1020275767 7:6623638-6623660 CCCCTGGTTCCCTGGAGGGAAGG - Exonic
1022345261 7:29508573-29508595 CCACTAGGGCCCCGGAAGGAGGG - Intronic
1023983217 7:45081483-45081505 CCCAAAGGTCCCCTGATGGATGG + Intronic
1023995257 7:45155820-45155842 CCCCTAGGTCCCTCTAAGGCAGG - Intergenic
1026953804 7:74364402-74364424 CCTCTAGGCCCCCCCGGGGAAGG + Intronic
1029525395 7:101090913-101090935 CCCCTAGTTCAGCCGAGTGAAGG - Intronic
1030605249 7:111633187-111633209 CCCCTGGGTCCCCAGGTGGAAGG + Intergenic
1034397248 7:150836512-150836534 CCACCAGGTCACCTGAGGGACGG - Intronic
1034467423 7:151238268-151238290 CCCCCAGGGCCCCCGGGGGCTGG + Exonic
1035341817 7:158167059-158167081 CCCCCAGCTCCCCCCGGGGAGGG - Exonic
1035368374 7:158362885-158362907 ACTCAAGGTCCCCAGAGGGACGG - Intronic
1036770010 8:11572364-11572386 CTCCTAGGTGCCCCCAGGGAAGG - Intergenic
1039912463 8:41835932-41835954 CCCATAGGCCCCACCAGGGAGGG + Intronic
1039954241 8:42195122-42195144 CCCCTAGGACGCTCGGGGGAGGG - Intronic
1041104181 8:54425396-54425418 CCCCTCGGCCCCTCCAGGGAGGG + Intergenic
1049573931 8:143381974-143381996 CCCCTGGGGCCCCAGAGGGGCGG + Intronic
1049800538 8:144515622-144515644 ACCCTAGCTCCCCTGAAGGAGGG - Intronic
1051342962 9:16128479-16128501 CCCCCAGGTCCCCGCAGGGCTGG + Intergenic
1057534941 9:95892272-95892294 TCCCTAGGTCCCTAGAGGAATGG - Intronic
1061050461 9:128191807-128191829 CCCCTCGATGCCCCGCGGGATGG - Intronic
1062078519 9:134605755-134605777 CCCCTAGGTCCCCAGAGAGCAGG + Intergenic
1185661277 X:1730879-1730901 CCCCTAGCTCCTCTGAGGCACGG + Intergenic
1189389467 X:40563880-40563902 CCCAGGGGTCCCACGAGGGAGGG - Intergenic
1192962298 X:76143826-76143848 CCCCCAGGAGCCCAGAGGGATGG - Intergenic
1192963235 X:76151261-76151283 CCCCCAGGAGCCCAGAGGGATGG + Intergenic