ID: 1175236282

View in Genome Browser
Species Human (GRCh38)
Location 20:57514494-57514516
Sequence GTACTGGCCCTGATACTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175236282_1175236287 -7 Left 1175236282 20:57514494-57514516 CCTCCCAGTATCAGGGCCAGTAC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1175236287 20:57514510-57514532 CCAGTACTTTGCAGGTTTATAGG 0: 1
1: 0
2: 1
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175236282 Original CRISPR GTACTGGCCCTGATACTGGG AGG (reversed) Intronic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
902367998 1:15989949-15989971 GCACTGGCCCAGATGCTGGCTGG + Intergenic
903368972 1:22822774-22822796 GCACTGGGCCTGAAACTGGACGG - Intronic
904270886 1:29349391-29349413 TGAATGGCCCTGATCCTGGGAGG + Intergenic
905400222 1:37696353-37696375 ATCCTGGCACTGATGCTGGGAGG - Intronic
908140578 1:61180139-61180161 GTGCTGGCCATGATGCTGGATGG - Intronic
911648901 1:100364844-100364866 TTACAGACCCTGATACTGGAAGG + Intronic
1069608801 10:69758399-69758421 GTACTGGCCCTGACACTCACTGG + Intergenic
1071294687 10:84211175-84211197 GCACTGGCCCAGGGACTGGGTGG + Intronic
1072762796 10:98071620-98071642 GTACTGGCCCAGATACAAAGAGG - Intergenic
1073815272 10:107199368-107199390 TTACTACCCCTGAAACTGGGTGG - Intergenic
1075001338 10:118800763-118800785 GTAGTGGCCCTGATTCTGAGAGG + Intergenic
1076691682 10:132226912-132226934 GTCGTGGACCTGCTACTGGGCGG - Exonic
1077109691 11:856642-856664 GTCCAGGCCCAGATGCTGGGTGG + Intronic
1080685348 11:34510859-34510881 GTACTGGCGCTGACACTAGGTGG - Intronic
1081565712 11:44259883-44259905 GTTCTGGCTCTGCTACTGAGTGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1085713300 11:78849945-78849967 GTACTGACCCTGGTCCTGGCTGG - Intronic
1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG + Intergenic
1091303586 11:134523401-134523423 GTTCTGGCTCTGACACGGGGAGG + Intergenic
1110273818 13:73620392-73620414 GTACTGGCTCTGAAACTTGCAGG + Intergenic
1113569916 13:111346310-111346332 GTTCTGGCCCTTCTCCTGGGGGG - Intergenic
1113800166 13:113082375-113082397 GTCCTGGGCCTGATGCTGTGGGG - Intronic
1114683560 14:24507039-24507061 GAAGTGGCCCTGAGACTGGGTGG + Intronic
1122531503 14:102430763-102430785 CTACTGGCCTTGATGCTGTGTGG + Intronic
1124993079 15:34695118-34695140 GTACTGGACTTAATACTGGGTGG + Intergenic
1132679775 16:1134948-1134970 GGACGGGCCCTGAAATTGGGAGG - Intergenic
1136636594 16:31528240-31528262 GGACTGGCCTGGAGACTGGGGGG + Intronic
1142116214 16:88357453-88357475 ATCCCGGCCCTGATCCTGGGAGG + Intergenic
1143887654 17:10076809-10076831 TTTCTCGCCCTGGTACTGGGAGG - Intronic
1145232711 17:21186262-21186284 GTACTGGGCCTCACACTGGCAGG + Intronic
1149294639 17:55250741-55250763 GTAAAGGCCCTGAGACTGGAAGG + Intergenic
1150281386 17:63931374-63931396 GTACTGGCTCAGCTGCTGGGTGG + Exonic
1151487114 17:74407894-74407916 GGACTGGCCCTCATTCTGGGTGG + Intergenic
1153999405 18:10471262-10471284 GGACTGGCTCTGATACTTGCTGG + Intronic
1161089116 19:2351466-2351488 GCACTGGCCCTGATGCAGCGTGG + Exonic
1165928315 19:39341296-39341318 GAACGGGCCCTGACACTGGCTGG - Intronic
1166137365 19:40785922-40785944 GTACTGGCCCTGACCCTCTGGGG - Intronic
925003208 2:422620-422642 GTCCTGGCCAGGAGACTGGGAGG - Intergenic
925158305 2:1663672-1663694 GTACTGGCCCTGGTCGTGGAGGG + Exonic
928244873 2:29618501-29618523 CTACTTGCCCTTATACTGGTGGG + Intronic
929028619 2:37629603-37629625 GACCTGGCCCTGATTCCGGGTGG + Intergenic
933809904 2:86026774-86026796 GTCCTGGCCCTGCCACTGTGTGG - Exonic
933902815 2:86861728-86861750 GTCCTGGCCCTGGTCCTGGCAGG - Intronic
935777732 2:106487541-106487563 GTCCTGGCCCTGGTCCTGGCAGG + Intergenic
943276716 2:185876598-185876620 GTGCTGGCTGTGATACTGAGAGG - Intergenic
947367976 2:229416370-229416392 GTACTGGCCAGGCTAGTGGGTGG + Intronic
948338687 2:237231736-237231758 TTGCTGGCCCTGTTACAGGGTGG + Intergenic
1169829340 20:9806462-9806484 GTTCTGTCCCTGGTTCTGGGAGG - Intronic
1171064058 20:21995750-21995772 GCTGTGGCCCTGCTACTGGGAGG - Intergenic
1171383545 20:24751891-24751913 GTGCTGGACCTGATACAGAGTGG - Intergenic
1175161575 20:57011774-57011796 GGACTGGCCCTGAGGCTTGGTGG - Intergenic
1175236282 20:57514494-57514516 GTACTGGCCCTGATACTGGGAGG - Intronic
1180108032 21:45632788-45632810 TTTCTGGCTCTGATACTAGGTGG + Intergenic
1180676996 22:17593598-17593620 GTAGTGGCTATGATACTGGATGG + Intronic
1181756077 22:25025978-25026000 CCAATGGCCCTGATTCTGGGTGG + Intronic
1183278191 22:36914580-36914602 GTACTGGCCCTGAGAATGAAAGG + Intronic
1183321192 22:37166185-37166207 GAAATGCCCCTGCTACTGGGGGG + Intronic
1183332688 22:37229861-37229883 GTCCTGGCTCTGATACTGATTGG - Intronic
949165338 3:933920-933942 GTACTGGCTCTGAAAGTGGATGG + Intergenic
951806680 3:26652255-26652277 GCTCTGTCCCTGAGACTGGGAGG + Intronic
953280116 3:41547039-41547061 TTACTGTCACTGATAGTGGGAGG + Intronic
958771724 3:98433762-98433784 GTACTGGCCCTGATAGTGATTGG - Intergenic
960541186 3:118864367-118864389 GTACTGGCACAGATACAGAGGGG - Intergenic
962993302 3:140599779-140599801 ATTCTGCCCCTGACACTGGGTGG - Intergenic
969138341 4:5049149-5049171 GTGCTGGCGCTGAGACTGGAAGG - Intergenic
976131091 4:81884704-81884726 GTACTAGCCCTTATAGTGGAAGG + Intronic
976390699 4:84501217-84501239 GTCCTAGCCTTGAAACTGGGGGG + Intergenic
982630227 4:157822049-157822071 GTGCTGGCGCAGATTCTGGGTGG + Intergenic
984876045 4:184368578-184368600 CTTCTTGCCCTGATACTGAGAGG + Intergenic
985542068 5:491993-492015 GTGCTGGGCCTGGTGCTGGGCGG - Exonic
985930747 5:3055752-3055774 GTCCTGGACCGGATGCTGGGTGG - Intergenic
987086386 5:14473070-14473092 GTACAGGCTCTGAACCTGGGTGG - Intronic
987735236 5:21831694-21831716 GTACTTGCCCTGATTCTCGGGGG + Intronic
988841486 5:35087809-35087831 GAATTTGCCCTGATACTGTGGGG + Intronic
996144337 5:119955347-119955369 ATATTGTCCCTGATTCTGGGAGG + Intergenic
998168860 5:139860283-139860305 GGCCTGGCACTGATGCTGGGAGG - Intronic
998736209 5:145144276-145144298 GTGCTGGCCCTAATCCTTGGGGG + Intergenic
1010940773 6:81915176-81915198 GTCCTGACCCTGACAGTGGGGGG - Intergenic
1017497532 6:154995209-154995231 GTCCTGGGCCTGACGCTGGGCGG + Intronic
1017771472 6:157648066-157648088 ATACTGGCTCTGACATTGGGTGG - Intronic
1019331560 7:463063-463085 GGCCTGGCCCTGATACAGCGGGG + Intergenic
1019865858 7:3709407-3709429 GTGCTGAACCTGATACAGGGAGG - Intronic
1026251523 7:68675135-68675157 GTCCTGGCCCTGATAGCAGGTGG - Intergenic
1027534631 7:79382004-79382026 GTGCTGGTCCTGATACTGCTGGG + Intronic
1029734039 7:102455713-102455735 GTTGGGGCCGTGATACTGGGAGG + Exonic
1033138102 7:138801431-138801453 GAACTGGCCCTCAGCCTGGGAGG + Intronic
1033707761 7:143905281-143905303 GGACTGGCTGTGATCCTGGGAGG + Intergenic
1034383757 7:150720833-150720855 GGCCTGGCCCTGCTGCTGGGGGG + Exonic
1047885175 8:129242277-129242299 GTACTGGCCCTAAAAATAGGAGG - Intergenic
1049350136 8:142159926-142159948 GTACTGGGCCTGCTTCTGGGTGG - Intergenic
1051596185 9:18826380-18826402 GTACAGGCCCTGATCCGAGGAGG - Exonic
1052496400 9:29230719-29230741 GTAATGGCAATGATACTGGTGGG - Intergenic
1052884774 9:33634106-33634128 GTACTGGTACTGGTACTGGCAGG + Intergenic
1057900984 9:98948114-98948136 GTGCTGGCCCTCATGCTGGCTGG + Intronic
1058098324 9:100888788-100888810 GTCTTGGCCCTGGTGCTGGGTGG - Intergenic
1060651411 9:125330115-125330137 GCACTGACCCTGAACCTGGGAGG - Exonic
1061829237 9:133280213-133280235 GGTCCAGCCCTGATACTGGGTGG + Intergenic
1062376420 9:136263887-136263909 GCCCTGGCCCTCACACTGGGAGG + Intergenic
1191210785 X:57882838-57882860 GTAGTGGCCCAGATGCTGGAAGG - Intergenic
1197808152 X:130416769-130416791 GTACTGGCCCTAATAAAGGAGGG - Intergenic