ID: 1175238116

View in Genome Browser
Species Human (GRCh38)
Location 20:57526692-57526714
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175238104_1175238116 5 Left 1175238104 20:57526664-57526686 CCTGCAGGGGGCACTGAGACCTG No data
Right 1175238116 20:57526692-57526714 GAATGGATAAGGAGGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175238116 Original CRISPR GAATGGATAAGGAGGGAGGA GGG Intergenic
No off target data available for this crispr