ID: 1175238161

View in Genome Browser
Species Human (GRCh38)
Location 20:57526810-57526832
Sequence GAATGGGTAAGGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175238144_1175238161 19 Left 1175238144 20:57526768-57526790 CCTGCAGGGGGCGCTGGGAGACC 0: 3
1: 4
2: 4
3: 39
4: 397
Right 1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG No data
1175238155_1175238161 -2 Left 1175238155 20:57526789-57526811 CCTAGGCGGGGCAGGGGTGGGGA No data
Right 1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175238161 Original CRISPR GAATGGGTAAGGAGGGAAGA AGG Intergenic
No off target data available for this crispr