ID: 1175238467

View in Genome Browser
Species Human (GRCh38)
Location 20:57528691-57528713
Sequence GCGTTCTTGGATAATATTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175238461_1175238467 7 Left 1175238461 20:57528661-57528683 CCTGCAGTTGCTAAACTTTGCTC No data
Right 1175238467 20:57528691-57528713 GCGTTCTTGGATAATATTTGTGG No data
1175238460_1175238467 29 Left 1175238460 20:57528639-57528661 CCAAGCAGGCAGGGGAGGCAGGC No data
Right 1175238467 20:57528691-57528713 GCGTTCTTGGATAATATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175238467 Original CRISPR GCGTTCTTGGATAATATTTG TGG Intergenic
No off target data available for this crispr