ID: 1175239191

View in Genome Browser
Species Human (GRCh38)
Location 20:57534076-57534098
Sequence GTTGCTCAGACACCCCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175239187_1175239191 -2 Left 1175239187 20:57534055-57534077 CCCACCTTGTGGCCTCTTGCTGT No data
Right 1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG No data
1175239189_1175239191 -6 Left 1175239189 20:57534059-57534081 CCTTGTGGCCTCTTGCTGTTGCT No data
Right 1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG No data
1175239183_1175239191 15 Left 1175239183 20:57534038-57534060 CCTATCTTCCACCTGCTCCCACC No data
Right 1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG No data
1175239188_1175239191 -3 Left 1175239188 20:57534056-57534078 CCACCTTGTGGCCTCTTGCTGTT No data
Right 1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG No data
1175239185_1175239191 7 Left 1175239185 20:57534046-57534068 CCACCTGCTCCCACCTTGTGGCC No data
Right 1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG No data
1175239186_1175239191 4 Left 1175239186 20:57534049-57534071 CCTGCTCCCACCTTGTGGCCTCT No data
Right 1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG No data
1175239182_1175239191 16 Left 1175239182 20:57534037-57534059 CCCTATCTTCCACCTGCTCCCAC No data
Right 1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG No data
1175239181_1175239191 19 Left 1175239181 20:57534034-57534056 CCACCCTATCTTCCACCTGCTCC No data
Right 1175239191 20:57534076-57534098 GTTGCTCAGACACCCCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175239191 Original CRISPR GTTGCTCAGACACCCCAAGC TGG Intergenic
No off target data available for this crispr