ID: 1175240359

View in Genome Browser
Species Human (GRCh38)
Location 20:57543086-57543108
Sequence GGCCACTATGAACAAGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175240357_1175240359 0 Left 1175240357 20:57543063-57543085 CCATTAGATGACAAAGACTGAGT No data
Right 1175240359 20:57543086-57543108 GGCCACTATGAACAAGCACCTGG No data
1175240356_1175240359 12 Left 1175240356 20:57543051-57543073 CCTAGATTTAGTCCATTAGATGA No data
Right 1175240359 20:57543086-57543108 GGCCACTATGAACAAGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175240359 Original CRISPR GGCCACTATGAACAAGCACC TGG Intergenic
No off target data available for this crispr