ID: 1175241436

View in Genome Browser
Species Human (GRCh38)
Location 20:57552421-57552443
Sequence CAGTAACAGCATCAGAAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241436_1175241441 5 Left 1175241436 20:57552421-57552443 CCTTACTTCTGATGCTGTTACTG No data
Right 1175241441 20:57552449-57552471 GTGGGATCAACTGCTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241436 Original CRISPR CAGTAACAGCATCAGAAGTA AGG (reversed) Intergenic
No off target data available for this crispr