ID: 1175241441

View in Genome Browser
Species Human (GRCh38)
Location 20:57552449-57552471
Sequence GTGGGATCAACTGCTCAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241432_1175241441 24 Left 1175241432 20:57552402-57552424 CCACCACACTCGGCCCAATCCTT No data
Right 1175241441 20:57552449-57552471 GTGGGATCAACTGCTCAGTGAGG No data
1175241434_1175241441 11 Left 1175241434 20:57552415-57552437 CCCAATCCTTACTTCTGATGCTG No data
Right 1175241441 20:57552449-57552471 GTGGGATCAACTGCTCAGTGAGG No data
1175241433_1175241441 21 Left 1175241433 20:57552405-57552427 CCACACTCGGCCCAATCCTTACT No data
Right 1175241441 20:57552449-57552471 GTGGGATCAACTGCTCAGTGAGG No data
1175241436_1175241441 5 Left 1175241436 20:57552421-57552443 CCTTACTTCTGATGCTGTTACTG No data
Right 1175241441 20:57552449-57552471 GTGGGATCAACTGCTCAGTGAGG No data
1175241435_1175241441 10 Left 1175241435 20:57552416-57552438 CCAATCCTTACTTCTGATGCTGT No data
Right 1175241441 20:57552449-57552471 GTGGGATCAACTGCTCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241441 Original CRISPR GTGGGATCAACTGCTCAGTG AGG Intergenic
No off target data available for this crispr