ID: 1175241481

View in Genome Browser
Species Human (GRCh38)
Location 20:57552694-57552716
Sequence TCTTTCCCTGGCTTGGCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241481_1175241486 6 Left 1175241481 20:57552694-57552716 CCTTGTGCCAAGCCAGGGAAAGA No data
Right 1175241486 20:57552723-57552745 GTATAACCTAGGCCGGCTTTTGG No data
1175241481_1175241484 -5 Left 1175241481 20:57552694-57552716 CCTTGTGCCAAGCCAGGGAAAGA No data
Right 1175241484 20:57552712-57552734 AAAGAAAACTTGTATAACCTAGG No data
1175241481_1175241485 -1 Left 1175241481 20:57552694-57552716 CCTTGTGCCAAGCCAGGGAAAGA No data
Right 1175241485 20:57552716-57552738 AAAACTTGTATAACCTAGGCCGG No data
1175241481_1175241491 24 Left 1175241481 20:57552694-57552716 CCTTGTGCCAAGCCAGGGAAAGA No data
Right 1175241491 20:57552741-57552763 TTTGGCAGAAAATTGGAAGGTGG No data
1175241481_1175241488 17 Left 1175241481 20:57552694-57552716 CCTTGTGCCAAGCCAGGGAAAGA No data
Right 1175241488 20:57552734-57552756 GCCGGCTTTTGGCAGAAAATTGG No data
1175241481_1175241490 21 Left 1175241481 20:57552694-57552716 CCTTGTGCCAAGCCAGGGAAAGA No data
Right 1175241490 20:57552738-57552760 GCTTTTGGCAGAAAATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241481 Original CRISPR TCTTTCCCTGGCTTGGCACA AGG (reversed) Intergenic
No off target data available for this crispr