ID: 1175241482

View in Genome Browser
Species Human (GRCh38)
Location 20:57552701-57552723
Sequence CAAGTTTTCTTTCCCTGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1175241482_1175241490 14 Left 1175241482 20:57552701-57552723 CCAAGCCAGGGAAAGAAAACTTG No data
Right 1175241490 20:57552738-57552760 GCTTTTGGCAGAAAATTGGAAGG No data
1175241482_1175241486 -1 Left 1175241482 20:57552701-57552723 CCAAGCCAGGGAAAGAAAACTTG No data
Right 1175241486 20:57552723-57552745 GTATAACCTAGGCCGGCTTTTGG No data
1175241482_1175241492 27 Left 1175241482 20:57552701-57552723 CCAAGCCAGGGAAAGAAAACTTG No data
Right 1175241492 20:57552751-57552773 AATTGGAAGGTGGAAAGCCATGG No data
1175241482_1175241488 10 Left 1175241482 20:57552701-57552723 CCAAGCCAGGGAAAGAAAACTTG No data
Right 1175241488 20:57552734-57552756 GCCGGCTTTTGGCAGAAAATTGG No data
1175241482_1175241491 17 Left 1175241482 20:57552701-57552723 CCAAGCCAGGGAAAGAAAACTTG No data
Right 1175241491 20:57552741-57552763 TTTGGCAGAAAATTGGAAGGTGG No data
1175241482_1175241485 -8 Left 1175241482 20:57552701-57552723 CCAAGCCAGGGAAAGAAAACTTG No data
Right 1175241485 20:57552716-57552738 AAAACTTGTATAACCTAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1175241482 Original CRISPR CAAGTTTTCTTTCCCTGGCT TGG (reversed) Intergenic